Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ACTG1

Gene ID (NCBI) 71
Gene Symbol ACTG1
Protein Name actin, gamma 1
Synonyms ACT|ACTG|BRWS2|DFNA20|DFNA26
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Hippo signaling (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K05692)


Genome Network Project (GNP) Human cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX005816 IRAK014I24 pCMV-SPORT6 BC009544 NM_001614 Partial
HGX046008 IRAK115A08 pCMV-SPORT6 BC053572 NM_001614 Full
HGY080411 IRAL001A11 pOTB7 BC000292 NM_001614 Full
HGY083715 IRAL009E19 pOTB7 BC001920 NM_001614 Full
HGY084087 IRAL010D15 pOTB7 BC007442 NM_001614 Full
HGY089461 IRAL023K21 pOTB7 BC017450 NM_001614 Partial
HGY090109 IRAL025E13 pOTB7 BC009848 NM_001614 Full
HGY090138 IRAL025F18 pOTB7 BC010999 NM_001614 Full
HGY090341 IRAL025O05 pOTB7 BC010417 NM_001614 Partial
HGY090446 IRAL026B22 pOTB7 BC023548 NM_001614 Partial
HGY091692 IRAL029D20 pOTB7 BC012050 NM_001614 Full
HGY093519 IRAL033N07 pOTB7 BC015695 NM_001614 Full
HGY093677 IRAL034D05 pOTB7 BC015779 NM_001614 Full
HGY093686 IRAL034D14 pOTB7 BC015005 NM_001614 Full
HGY096248 IRAL040K08 pOTB7 BC018774 NM_001614 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040481 ARe01D09 pKA1U5 NM_001614.2  
GGGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGT
HKR040971 ARe02H03 pKA1U5 NM_001614.2  
GCGCTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTTCTTCCGCCGCTCCGCCGTCGC
HKR042854 ARe07C06 pKA1U5 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGNTTCTTCCGCCGCATCCGCCGTCGCGNT
HKR042977 ARe07H09 pKA1U5 NM_001614.2  
GGGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGT
HKR043259 ARe08C11 pKA1U5 NM_001614.2  
GCTCAGNTCGCCGCTGCCAACTCTCGCACTCTGATTCTTCCGCCGCNTCCGCCGCCGCGN
HKR043769 ARe09H01 pKA1U5 NM_001614.2  
GGGTCTCAGNTCGCCGCTGCCAACTCTCGCACTCTGNTTCTTCCGCCGCTCCGCCGTCGC
HKR080570 ARf01H02 pKA1U5 NM_001614.2  
GCTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTT
HKR081226 ARf03B02 pKA1U5 NM_001614.2  
GGGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGT
HKR081375 ARf03H07 pKA1U5 NM_001614.2  
TGGTCTCAGNTCGCCGCTGCCAACTCTCGCACTCTGNTTCTTCCGCCGCTCCGCCGTCGC
HKR081631 ARf04B07 pKA1U5 NM_001614.2  
GCTCAGATCGCCGCTGCCAACTCTCGCACTCTGNTTCTTCCGCCGCTCCGCCGNTCGCGT
HKR081651 ARf04C03 pKA1U5 NM_001614.2  
GGGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGT
HKR081779 ARf04H11 pKA1U5 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR082006 ARf05A06 pKA1U5 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR082129 ARf05F09 pKA1U5 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR160908 ARi02E12 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR160947 ARi02G03 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR161657 ARi04C09 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR161728 ARi04F08 pGCAP10 NM_001614.2  
GCTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTT
HKR162497 ARi06E01 pGCAP10 NM_001614.2  
GGGTCTCAGTCGCCGCTGCCAACTTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCG
HKR163698 ARi09E02 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR044574 ARe11H06 pKA1U5 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR044926 ARe12F06 pKA1U5 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCGTCCGCCGTCGCGTTT
HKR044972 ARe12H04 pKA1U5 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR045351 ARe13G07 pKA1U5 NM_001614.2  
GGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTT
HKR045649 ARe14C01 pKA1U5 NM_001614.2  
GGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTT
HKR046905 ARe17E09 pKA1U5 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR047346 ARe18G02 pKA1U5 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGCTTCTTCCGCCGCATCCGCCGTCGCGAT
HKR047630 ARe19B06 pKA1U5 NM_001614.2  
GGGTCTCAGNTCGCCGCTGCCAACTCTCGCACTCTGNTTCTTCCGCCGCTCCGCCGNTCG
HKR047682 ARe19D10 pKA1U5 NM_001614.2  
GGGTCTCAGNTCGCCGCTGCCAACTCATCGCACTCNGTTTCTTCCGCCGCTCCGCCGATC
HKR164122 ARi10F02 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTT
HKR164156 ARi10G12 pGCAP10 NM_001614.2  
GAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTCTCT
HKR164482 ARi11D10 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR164555 ARi11G11 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR164877 ARi12D05 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR164947 ARi12G03 pGCAP10 NM_001614.2  
TGGCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTT
HKR165700 ARi14E04 pGCAP10 NM_001614.2  
GGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTT
HKR166099 ARi15E03 pGCAP10 NM_001614.2  
GCTCANGCGCCGCTGCCACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTCT
HKR166930 ARi17F10 pGCAP10 NM_001614.2  
GGGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGT
HKR048004 ARe20A04 pKA1U5 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR048807 ARe22A07 pKA1U5 NM_001614.2  
ATCCTGGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTC
HKR049721 ARe24F01 pKA1U5 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR050074 ARe25D02 pKA1U5 NM_001614.2  
GCTCAGNTCGCCGCTGCCAACTCTCGCACTCTGNTTCTTCCGCCGCTCCGCCGNTCGCGN
HKR050474 ARe26D02 pKA1U5 NM_001614.2  
GGTCTCAGNTCGCCGCTGCCAACTCTCGCACTCTGNTTCTTCCGCCGCTCCGCCGATCGC
HKR050976 ARe27H08 pKA1U5 NM_001614.2  
GGGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTTCTTCCGCCGCTCCGCCGTCGCG
HKR051370 ARe28H02 pKA1U5 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR051679 ARe29D07 pKA1U5 NM_001614.2  
GCTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTT
HKR051681 ARe29D09 pKA1U5 NM_001614.2  
GCTCAGNTCGCCGCTGCCAACTCTCGCACTCTGNTTCTTCCGCCGCATCCGCCGNTCGCG
HKR051749 ARe29G05 pKA1U5 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR168455 ARi21C07 pGCAP10 NM_001614.2  
GAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTCTCT
HKR168875 ARi22D03 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR169700 ARi24E04 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR170148 ARi25G04 pGCAP10 NM_001614.2  
GGGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGT
HKR171230 ARi28B06 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR171347 ARi28G03 pGCAP10 NM_001614.2  
GGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTT
HKR052052 ARe30C04 pKA1U5 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR052122 ARe30F02 pKA1U5 NM_001614.2  
GGGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGT
HKR052410 ARe31A10 pKA1U5 NM_001614.2  
GAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCATCCGCCGTCGCGTTTCTC
HKR172009 ARi30A09 pGCAP10 NM_001614.2  
GGGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGT
HKR172057 ARi30C09 pGCAP10 NM_001614.2  
CCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR172479 ARi31D07 pGCAP10 NM_001614.2  
GGGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGT
HKR172806 ARi32A06 pGCAP10 NM_001614.2  
CGGCCGGCCGATGGGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCT
HKR173633 ARi34B09 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR173679 ARi34D07 pGCAP10 NM_001614.2  
GGGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGT
HKR173702 ARi34E06 pGCAP10 NM_001614.2  
GCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTCTC
HKR174176 ARi35H08 pGCAP10 NM_001614.2  
GGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTT
HKR174970 ARi37H02 pGCAP10 NM_001614.2  
GCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTCTC
HKR175253 ARi38C05 pGCAP10 NM_001614.2  
GGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTT
HKR175275 ARi38D03 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR056401 ARe41A01 pKA1U5 NM_001614.2  
GGGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGT
HKR056529 ARe41F09 pKA1U5 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR056908 ARe42E12 pKA1U5 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR056972 ARe42H04 pKA1U5 NM_001614.2  
GGGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTTCTTCCGCCGCTCCGCCGTCGCG
HKR057281 ARe43D09 pKA1U5 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGATTT
HKR057676 ARe44D04 pKA1U5 NM_001614.2  
GGGATCTCAGNTCGCCGCTGCCAACTCTCGCACTCNGNTTNTTCCGCCGCTCCGCCGATC
HKR057723 ARe44F03 pKA1U5 NM_001614.2  
GAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTCTCT
HKR058055 ARe45C07 pKA1U5 NM_001614.2  
ATCCTGGGGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCG
HKR058056 ARe45C08 pKA1U5 NM_001614.2  
GGGTCTCAGNTCGCCGCTGCCAACTCTCGCACTCTGNTTCTTCCGCCGCTCCGCCGNTCG
HKR058106 ARe45E10 pKA1U5 NM_001614.2  
GGGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGNTTCTTCCGCCGCTCCGCCGTCGCG
HKR058429 ARe46B05 pKA1U5 NM_001614.2  
GGGTCTCAGNTCGCCGCTGCCAACTCTCGCACTCTGNTTCTTCCGCCGCTCCGCCGNTCG
HKR058458 ARe46C10 pKA1U5 NM_001614.2  
GAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTCTCT
HKR058484 ARe46D12 pKA1U5 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR058905 ARe47E09 pKA1U5 NM_001614.2  
GGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGCTTCTTCCGCCGCTCCGCCGTCGCGT
HKR059371 ARe48H03 pKA1U5 NM_001614.2  
TGGCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTT
HKR176027 ARi40B03 pGCAP10 NM_001614.2  
GGGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGT
HKR176450 ARi41C02 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR176507 ARi41E11 pGCAP10 NM_001614.2  
GGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTT
HKR176834 ARi42B10 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR177275 ARi43D03 pGCAP10 NM_001614.2  
CAGGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCG
HKR177298 ARi43E02 pGCAP10 NM_001614.2  
GGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTT
HKR178098 ARi45E02 pGCAP10 NM_001614.2  
GGTCAGTCGCCGCTGCCAACTCTCACACTCTGTTCTTCTGCCCCCCCGCCGTCCCGCTTT
HKR178450 ARi46C02 pGCAP10 NM_001614.2  
CGGCCGGCCGATGCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCG
HKR178803 ARi47A03 pGCAP10 NM_001614.2  
GGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTT
HKR179255 ARi48C07 pGCAP10 NM_001614.2  
GGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTT
HKR179297 ARi48E01 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR179634 ARi49B10 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR060897 ARe52E01 pKA1U5 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR061229 ARe53B05 pKA1U5 NM_001614.2  
GGTCTCAGNTCGCCGCTGCCAACTCTCGCACATCTGNTTCTTCCGCCGCTCCGCCGNTCG
HKR061258 ARe53C10 pKA1U5 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR061349 ARe53G05 pKA1U5 NM_001614.2  
GCTCAGATCGCCGCTGCCAACTCTCGCACTCTGNTTCTTCCGCCGCATCCGCCGATCGCG
HKR061660 ARe54C12 pKA1U5 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR061771 ARe54H03 pKA1U5 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR062001 ARe55A01 pKA1U5 NM_001614.2  
GGGTCTCAGNTCGCCGCATGCCAACTCTCGCACTCTGTTTCTTCCGCCGCTCCGCCGATC
HKR062106 ARe55E10 pKA1U5 NM_001614.2  
GTCTCAGATCGCCGCTGCCAACTCTCGCACTCTGNTCTTNCGCCGCTCCGCCGTCGCGTT
HKR062980 ARe57H12 pKA1U5 NM_001614.2  
GGGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGT
HKR063258 ARe58C10 pKA1U5 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR063276 ARe58D04 pKA1U5 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGNTTCTTCCGCCGCTCCGCCGNTCGCGTT
HKR180056 ARi50C08 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR180129 ARi50F09 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR180802 ARi52A02 pGCAP10 NM_001614.2  
GGGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGT
HKR180857 ARi52C09 pGCAP10 NM_001614.2  
GGGTCTCAAAATNNCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCCCG
HKR181321 ARi53F01 pGCAP10 NM_001614.2  
GGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTT
HKR181345 ARi53G01 pGCAP10 NM_001614.2  
GGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTT
HKR182925 ARi57F05 pGCAP10 NM_001614.2  
GGGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGT
HKR183209 ARi58A09 pGCAP10 NM_001614.2  
TGCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTT
HKR183727 ARi59F07 pGCAP10 NM_001614.2  
GTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTT
HKR183730 ARi59F10 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR064171 ARe60H03 pKA1U5 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR064522 ARe61F02 pKA1U5 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGATTT
HKR065280 ARe63D08 pKA1U5 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR065282 ARe63D10 pKA1U5 NM_001614.2  
GGGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGNTTCTTCCGCCGCTCCGCCGTCGCG
HKR065649 ARe64C01 pKA1U5 NM_001614.2  
TGCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTT
HKR066027 ARe65B03 pKA1U5 NM_001614.2  
GGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTT
HKR066154 ARe65G10 pKA1U5 NM_001614.2  
ATCCTGGGGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCG
HKR067210 ARe68A10 pKA1U5 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR067654 ARe69C06 pKA1U5 NM_001614.2  
GTTCTTCCGCCGCTCCGCCGTCGCGTTTCTCTGCCGGTCGCAATGGAAGAAGAGATCGCC
HKR067771 ARe69H03 pKA1U5 NM_001614.2  
GGTCTCAGTCGCCGCTTGCCAACTCTCGCACTCTGTTTCTTCCGCCGCTCCGCCGTCGCG
HKR185330 ARi63F10 pGCAP10 NM_001614.2  
GGGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGT
HKR185603 ARi64A03 pGCAP10 NM_001614.2  
GGGTCTCAGTCGCCGCTGCACTCTCGCACTCTGTCTCGCGCTCNNGGTCGCGTTCTCTGN
HKR185635 ARi64B11 pGCAP10 NM_001614.2  
GAGTCGCCGCTGCCAA
HKR185746 ARi64G02 pGCAP10 NM_001614.2  
GGTCGCCGCTGCCAA
HKR185771 ARi64H03 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCACTCTCGCACTCTGTTCTTCCGNNNCTCNCCGTCGCGTTCTCT
HKR186433 ARi66B09 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR186577 ARi66H09 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR187303 ARi68E07 pGCAP10 NM_001614.2  
GGGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGT
HKR187630 ARi69B06 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR068580 ARe71H12 pKA1U5 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGNTTCTTCCGCCGCTCCGCCGTCGCGTTT
HKR068902 ARe72E06 pKA1U5 NM_001614.2  
GAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTCTCT
HKR068921 ARe72F01 pKA1U5 NM_001614.2  
GGGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTTCTTCCGCCGCTCCGCCGTCGCG
HKR069777 ARe74H09 pKA1U5 NM_001614.2  
GAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTCTCT
HKR070026 ARe75B02 pKA1U5 NM_001614.2  
GGGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTTCTTCCGCCGCTCCGCCGATCGC
HKR070155 ARe75G11 pKA1U5 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGCTTCTTCCGCCGCTCCGCCGTCGCGTTT
HKR070575 ARe76H07 pKA1U5 NM_001614.2  
GGGTCTCAGTCGCCGCTGCCAACTCTCGCACNCCGTTNAANTCCGCCGCTCCGCCGTCGC
HKR071636 ARe79B12 pKA1U5 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR071651 ARe79C03 pKA1U5 NM_001614.2  
GGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTCTCTG
HKR071701 ARe79E05 pKA1U5 NM_001614.2  
GGGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGT
HKR188146 ARi70G02 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR188401 ARi71A01 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR188550 ARi71G06 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR072859 ARe82C11 pKA1U5 NM_001614.2  
TGGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGNTTCTTCCGCCGCTCCGCCGTCGCG
HKR073201 ARe83A01 pKA1U5 NM_001614.2  
GGGTCTCAGNTCGCCGCTGCCAACTCTCGCACTCTGNTTCTTCCGCCGCTCCGCCGATCG
HKR073632 ARe84B08 pKA1U5 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR074009 ARe85A09 pKA1U5 NM_001614.2  
GGGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGNTTCTTCCGCCGCTCCGCCGTCGCG
HKR074526 ARe86F06 pKA1U5 NM_001614.2  
GGGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGT
HKR074551 ARe86G07 pKA1U5 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGCTTCTTCCGCCGCTCCGCCGTCGCGTTT
HKR075274 ARe88D02 pKA1U5 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGNTTCTTCCGCCGCTCCGCCGTCGCGTTT
HKR076053 ARe90C05 pKA1U5 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGNTCGCGTTT
HKR076579 ARe91H11 pKA1U5 NM_001614.2  
GGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGCTTCTTCCGCCGCTCCGCCGTCGCGT
HKR076901 ARe92E05 pKA1U5 NM_001614.2  
TGGGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCG
HKR076948 ARe92G04 pKA1U5 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR077260 ARe93C12 pKA1U5 NM_001614.2  
GAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTCTCT
HKR078178 ARe95H10 pKA1U5 NM_001614.2  
GGGTCTCAGATCGCCGCCTGTCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCG
HKR078528 ARe96F08 pKA1U5 NM_001614.2  
GGGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGT
HKR078826 ARe97B02 pKA1U5 NM_001614.2  
GTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTT
HKR078832 ARe97B08 pKA1U5 NM_001614.2  
GGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTT
HKR203225 ARiS008B01 pGCAP10 NM_001614.2  
GGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTT
HKR203316 ARiS008E20 pGCAP10 NM_001614.2  
GAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTCTCT
HKR203448 ARiS008K08 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCNGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR203544 ARiS008O08 pGCAP10 NM_001614.2  
GGGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGT
HKR205233 ARiS013B09 pGCAP10 NM_001614.2  
GCTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTT
HKR205288 ARiS013D16 pGCAP10 NM_001614.2  
GGGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGT
HKR205462 ARiS013K22 pGCAP10 NM_001614.2  
GGGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGT
HKR205555 ARiS013O19 pGCAP10 NM_001614.2  
GGGTCTCANTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGT
HKR208016 ARiS020A16 pGCAP10 NM_001614.2  
TGCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTT
HKR208191 ARiS020H23 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR208192 ARiS020H24 pGCAP10 NM_001614.2  
GTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTCT
HKR209212 ARiS023A12 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR218100 ARiS045E04 pGCAP10 NM_001614.2  
GGGTCTCATTCNCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGT
HKR218190 ARiS045H22 pGCAP10 NM_001614.2  
GGGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGT
HKR218306 ARiS045M18 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR218308 ARiS045M20 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR218352 ARiS045O16 pGCAP10 NM_001614.2  
GGGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGT
HKR222050 ARiS055C02 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGCTTCTTCCGCCGCTCCGCCGTCGCGTTT
HKR222078 ARiS055D06 pGCAP10 NM_001614.2  
GGGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGT
HKR222096 ARiS055D24 pGCAP10 NM_001614.2  
GGGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGT
HKR234120 ARiS085E24 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR234125 ARiS085F05 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR234823 ARiS087A23 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR234849 ARiS087C01 pGCAP10 NM_001614.2  
GGCTCAGTCGCCGCTGCCAACTCTCGCACTCTGCTTCTTCCGCCGCTCCGCCGTCGCGTT
HKR235126 ARiS087N14 pGCAP10 NM_001614.2  
TGCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTT
HKR238411 ARiS096A11 pGCAP10 NM_001614.2  
GGGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGT
HKR238427 ARiS096B03 pGCAP10 NM_001614.2  
GAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTCTCT
HKR238643 ARiS096K03 pGCAP10 NM_001614.2  
GCTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTT
HKR238647 ARiS096K07 pGCAP10 NM_001614.2  
GGGTCTCANTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGT
HKR238717 ARiS096N05 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTNCCAANTCTCNCACTCTGTTCTTCNGCCGCTCCGCCGTCGCGTTTC
HKR243605 ARiS109A05 pGCAP10 NM_001614.2  
GCTCTCAGTCNCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTT
HKR243647 ARiS109B23 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR243690 ARiS109D18 pGCAP10 NM_001614.2  
GAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTCTCT
HKR243702 ARiS109E06 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR243804 ARiS109I12 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR243833 ARiS109J17 pGCAP10 NM_001614.2  
GGGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGT
HKR243871 ARiS109L07 pGCAP10 NM_001614.2  
GGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTT
HKR243886 ARiS109L22 pGCAP10 NM_001614.2  
GGGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGT
HKR247514 ARiS118N02 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR247539 ARiS118O03 pGCAP10 NM_001614.2  
GGGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGT
HKR248858 ARiS122C10 pGCAP10 NM_001614.2  
GGGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGT
HKR248950 ARiS122G06 pGCAP10 NM_001614.2  
GGGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGT
HKR249037 ARiS122J21 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR249058 ARiS122K18 pGCAP10 NM_001614.2  
GAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTCTCT
HKR249064 ARiS122K24 pGCAP10 NM_001614.2  
GGGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGT
HKR249094 ARiS122M06 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR249162 ARiS122P02 pGCAP10 NM_001614.2  
GCGGTCTCAGTCGCCGCNNCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCG
HKR260026 ARiS150B02 pGCAP10 NM_001614.2  
GGTCTCAGTCGCCGCTGCCNACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTT
HKR260087 ARiS150D15 pGCAP10 NM_001614.2  
GGGTCTCANTCGCCGCTGCCNNCTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGT
HKR260112 ARiS150E16 pGCAP10 NM_001614.2  
GGGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGT
HKR260306 ARiS150M18 pGCAP10 NM_001614.2  
GGGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGT
HKR264483 ARiS161D11 pGCAP10 NM_001614.2  
GGTCTNNNTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCNCGTT
HKR264578 ARiS161H10 pGCAP10 NM_001614.2  
TTGCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTT
HKR264589 ARiS161H21 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR264657 ARiS161K17 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR276579 ARiS191H11 pGCAP10 NM_001614.2  
GTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTCT
HKR276622 ARiS191J06 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR276644 ARiS191K04 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR276726 ARiS191N14 pGCAP10 NM_001614.2  
GGGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGT
HKR277874 ARiS194L10 pGCAP10 NM_001614.2  
GTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTCT
HKR277886 ARiS194L22 pGCAP10 NM_001614.2  
CGGCCGGCCGATGGGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCT
HKR279211 ARiS198A11 pGCAP10 NM_001614.2  
GNNCAGTCNCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR279334 ARiS198F14 pGCAP10 NM_001614.2  
GGGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGT
HKR279356 ARiS198G12 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR279388 ARiS198H20 pGCAP10 NM_001614.2  
GGTCNCAGTCGCCGCNGCCAACTCTCGCACTCNGTTCTTCCGCCGCTCCGCCGTCGCGTT
HKR279411 ARiS198I19 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGCTTCTTCCGCCGCTCCGCCGTCGCGTTT
HKR322554 RBb06G10 pKA1U5 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR360426 RBd01B02 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR360879 RBd02D07 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR362059 RBd05C11 pGCAP10 NM_001614.2  
GGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTT
HKR362907 RBd07E11 pGCAP10 NM_001614.2  
GAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTCTCT
HKR324034 RBb10B10 pKA1U5 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR324499 RBb11E03 pKA1U5 NM_001614.2  
ATCCTGTGCTCAGTCGCCGCTGCCAACTCTCGCACTCTTGTTCTTCCGCCGCTCCGCCGT
HKR327208 RBb18A08 pKA1U5 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR366498 RBd16E02 pGCAP10 NM_001614.2  
TGCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTT
HKR367373 RBd18H05 pGCAP10 NM_001614.2  
TGGCTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCG
HKR328409 RBb21A09 pKA1U5 NM_001614.2  
GGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTT
HKR370172 RBd25H04 pGCAP10 NM_001614.2  
GGGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGT
HKR333305 RBb33E09 pGCAP1 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTTCGCGTTT
HKR334476 RBb36D04 pGCAP1 NM_001614.2  
GCTAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTCT
HKR334478 RBb36D06 pGCAP1 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR334497 RBb36E01 pGCAP1 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR336059 RBb40C11 pGCAP1 NM_001614.2  
TGGCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTT
HKR336153 RBb40G09 pGCAP1 NM_001614.2  
TGGCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTT
HKR338524 RBb46F04 pGCAP1 NM_001614.2  
GCTAGTCGCCGCTGCCAACTACTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR376034 RBd40B10 pGCAP10 NM_001614.2  
GGGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGT
HKR376078 RBd40D06 pGCAP10 NM_001614.2  
GGGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGT
HKR377303 RBd43E07 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR378851 RBd47C03 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR342126 RBb55F06 pGCAP1 NM_001614.2  
GCTCAGTTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTT
HKR342150 RBb55G06 pGCAP1 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR342853 RBb57C05 pGCAP1 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR343252 RBb58C04 pGCAP1 NM_001614.2  
GGGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGT
HKR380949 RBd52G05 pGCAP10 NM_001614.2  
GGGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGT
HKR381273 RBd53D01 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR381278 RBd53D06 pGCAP10 NM_001614.2  
GAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTCTCT
HKR381602 RBd54A02 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCNCCGCCGTCGCGTTTC
HKR381629 RBd54B05 pGCAP10 NM_001614.2  
TGGGGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCNNCGCTCCGCCGTCGC
HKR381674 RBd54D02 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR382425 RBd56B01 pGCAP10 NM_001614.2  
CGGCCGGCCGATGCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCG
HKR382478 RBd56D06 pGCAP10 NM_001614.2  
GAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCNTNGTCGCGTTTCTCT
HKR345776 RBb64H08 pGCAP1 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR347251 RBb68C03 pGCAP1 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR347276 RBb68D04 pGCAP1 NM_001614.2  
GGGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGT
HKR386107 RBd65E11 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR387250 RBd68C02 pGCAP10 NM_001614.2  
GGGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGT
HKR348554 RBb71G10 pGCAP1 NM_001614.2  
GGGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGT
HKR392833 RBd82B09 pGCAP10 NM_001614.2  
GGGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGT
HKR394007 RBd85A07 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR394032 RBd85B08 pGCAP10 NM_001614.2  
GCTCANTCNCCCCTGCCNNCTCTCGNACTCTGTTCTTCCCCCCCTCCNCCNTCGCGTTTC
HKR394475 RBd86D03 pGCAP10 NM_001614.2  
GGGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGT
HKR394549 RBd86G05 pGCAP10 NM_001614.2  
GGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTT
HKR396410 RBd91A10 pGCAP10 NM_001614.2  
GGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTT
HKR396833 RBd92B09 pGCAP10 NM_001614.2  
GAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTCTCT
HKR396900 RBd92E04 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR402912 RBdS007E16 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR403175 RBdS007P15 pGCAP10 NM_001614.2  
GAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTCTCT
HKR406258 RBdS015K18 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR416152 RBdS040G08 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR416166 RBdS040G22 pGCAP10 NM_001614.2  
GGGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGT
HKR420506 RBdS051E10 pGCAP10 NM_001614.2  
GAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTCTCT
HKR420522 RBdS051F02 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR428008 RBdS070A08 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR428087 RBdS070D15 pGCAP10 NM_001614.2  
TGGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTCTCT
HKR428148 RBdS070G04 pGCAP10 NM_001614.2  
GGGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGT
HKR430042 RBdS075B18 pGCAP10 NM_001614.2  
GCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTCTC
HKR430056 RBdS075C08 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR430065 RBdS075C17 pGCAP10 NM_001614.2  
GGGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGT
HKR430119 RBdS075E23 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR430168 RBdS075G24 pGCAP10 NM_001614.2  
GGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTT
HKR433467 RBdS083L03 pGCAP10 NM_001614.2  
GGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTT
HKR441874 RBdS104L10 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR441895 RBdS104M07 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR442233 RBdS105J17 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR442252 RBdS105K12 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR444050 RBdS110C02 pGCAP10 NM_001614.2  
GAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTCTCT
HKR444051 RBdS110C03 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR453052 RBdS132K12 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
HKR461798 RBdS154I06 pGCAP10 NM_001614.2  
GNCNTTGTTTCCCCGCNGCCACCTCCCGCCNNNNGTGCTNCCTGCNNTCCNANANTNGNG
HKR461861 RBdS154K21 pGCAP10 NM_001614.2  
GAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTCTCT
HKR461923 RBdS154N11 pGCAP10 NM_001614.2  
GCTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTT
HKR462667 RBdS156L03 pGCAP10 NM_001614.2  
GGGTCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGT
HKR474854 RBdS187C06 pGCAP10 NM_001614.2  
GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.05.31

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl