Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS105K12

Clone ID RBdS105K12
HP ID HP00109
Gene ID 71
Gene Symbol ACTG1
Protein Name actin, gamma 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001614.2
Length of RefSeq (bp) 1919
Chromosome 17q25
Reference DDBJ accession
UniGene Hs.514581
5'-terminal sequence GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTC
2011.08.28