Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ACTB

Gene ID (NCBI) 60
Gene Symbol ACTB
Protein Name actin, beta
Synonyms BRWS1|PS1TP5BP1
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Hippo signaling (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K05692)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB13280 pUC-T7-HCV-beta-actin-HA HCV IRES-dependent expression vector of human betaactin
RDB13284 pUC-T7-HCV-HA-beta-actin HCV IRES-dependent expression vector of human beta-actin

RDB_org_170226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX001655 IRAK004C07 pCMV-SPORT6 BC001301 NM_001101 Full
HGX005036 IRAK012J20 pCMV-SPORT6 BC008633 NM_001101 Partial
HGX005422 IRAK013J06 pCMV-SPORT6 BC014861 NM_001101 Full
HGX005731 IRAK014F11 pCMV-SPORT6 BC009636 NM_001101
HGX008569 IRAK021H01 pCMV-SPORT6 BC012854 NM_001101 Partial/var
HGY080726 IRAL001N14 pOTB7 BC002409 NM_001101 Full
HGY085394 IRAL013I02 pOTB7 BC004251 NM_001101 Full
HGY090310 IRAL025M22 pOTB7 BC013380 NM_001101 Full
HGY091767 IRAL029G23 pOTB7 BC016045 NM_001101 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040412 ARe01A12 pKA1U5 NM_001101.3  
TCCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCCC
HKR041327 ARe03F07 pKA1U5 NM_001101.3  
ATCCTGGACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCC
HKR042078 ARe05D06 pKA1U5 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGCAGCCTCGCCTTTGCCGATCCGCCGC
HKR042570 ARe06H02 pKA1U5 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGNCTCGCCTTTGCCGATCCGCCGCC
HKR042807 ARe07A07 pKA1U5 NM_001101.3  
ATCCTGTGTCCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATC
HKR080902 ARf02E06 pKA1U5 NM_001101.3  
GGCCGAGACCGCGNTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCCCG
HKR080930 ARf02F10 pKA1U5 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR080950 ARf02G06 pKA1U5 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR081208 ARf03A08 pKA1U5 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR081211 ARf03A11 pKA1U5 NM_001101.3  
GACCGCCGAGACCGCGNTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGC
HKR081754 ARf04G10 pKA1U5 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR081771 ARf04H03 pKA1U5 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR082426 ARf06B02 pKA1U5 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR082499 ARf06E03 pKA1U5 NM_001101.3  
ATCCTGTCCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCG
HKR160579 ARi01H11 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR161251 ARi03C03 pGCAP10 NM_001101.3  
GGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCCCGT
HKR161297 ARi03E01 pGCAP10 NM_001101.3  
GGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCCCGT
HKR162425 ARi06B01 pGCAP10 NM_001101.3  
GGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCCCGT
HKR162556 ARi06G12 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR163331 ARi08F11 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR163657 ARi09C09 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR163684 ARi09D12 pGCAP10 NM_001101.3  
GTGACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCG
HKR163749 ARi09G05 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR044156 ARe10G12 pKA1U5 NM_001101.3  
GGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCCCGT
HKR045632 ARe14B08 pKA1U5 NM_001101.3  
GACCGCCGTAGACCGCGTCCGCCCCGCGAGCACAGAGNCTCGCCTTTGCCGATCCGCCGC
HKR046058 ARe15C10 pKA1U5 NM_001101.3  
ATCCTGGACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCC
HKR046502 ARe16E06 pKA1U5 NM_001101.3  
GACCGCCGAGACCGCGNTCCGCCCCGCGAGCACANAGTCTCGCCTTTGCCGATCCGCCGC
HKR046810 ARe17A10 pKA1U5 NM_001101.3  
TGACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGC
HKR047699 ARe19E03 pKA1U5 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR047708 ARe19E12 pKA1U5 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR047772 ARe19H04 pKA1U5 NM_001101.3  
GGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCCCGT
HKR164056 ARi10C08 pGCAP10 NM_001101.3  
GGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCCCGT
HKR164099 ARi10E03 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR164483 ARi11D11 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR164573 ARi11H05 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR165235 ARi13B11 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR165679 ARi14D07 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR165682 ARi14D10 pGCAP10 NM_001101.3  
GACCGCCGAAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGC
HKR166076 ARi15D04 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR167298 ARi18E02 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR048929 ARe22F09 pKA1U5 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACANANTCTCGCCTTTGCCGATCCGCCGCC
HKR048979 ARe22H11 pKA1U5 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR050479 ARe26D07 pKA1U5 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR050825 ARe27B01 pKA1U5 NM_001101.3  
GGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCCCGT
HKR051611 ARe29A11 pKA1U5 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR168454 ARi21C06 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR168835 ARi22B11 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR168946 ARi22G02 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR169701 ARi24E05 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR170551 ARi26G07 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR171681 ARi29D09 pGCAP10 NM_001101.3  
GACCGCCCAGACCGCCTCCGCCCCGCGAGCTGCNGCCTCNCCTTTGCCGATCCGCCGCCC
HKR052946 ARe32G02 pKA1U5 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGTNTCGCCTTTGCCGATCCGCCGCC
HKR053298 ARe33E02 pKA1U5 NM_001101.3  
GACCGCCGAGACCGCGNTCCGCCCCGCGAGCACAGAGTNTCGCCTTTGCCGATCCGCCGC
HKR053346 ARe33G02 pKA1U5 NM_001101.3  
ACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGCAGCCTCGCCTTTGCCGATCCGCCGCC
HKR053650 ARe34C02 pKA1U5 NM_001101.3  
CTGACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCG
HKR053728 ARe34F08 pKA1U5 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR053778 ARe34H10 pKA1U5 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGNCTCGCCTTTGCCGATCCGCCGCC
HKR054475 ARe36D03 pKA1U5 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR054901 ARe37E05 pKA1U5 NM_001101.3  
ATCCTGACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCG
HKR055355 ARe38G11 pKA1U5 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR055659 ARe39C11 pKA1U5 NM_001101.3  
ATCCTGGACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCC
HKR055750 ARe39G06 pKA1U5 NM_001101.3  
ATCCTGAAAGACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGA
HKR172028 ARi30B04 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR172131 ARi30F11 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR172147 ARi30G03 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR172480 ARi31D08 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR172833 ARi32B09 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR173228 ARi33B04 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR173628 ARi34B04 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR174051 ARi35C03 pGCAP10 NM_001101.3  
GGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCCCGT
HKR174128 ARi35F08 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR174449 ARi36C01 pGCAP10 NM_001101.3  
CGGCCGGCCGATGACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGC
HKR174524 ARi36F04 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR174877 ARi37D05 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR175201 ARi38A01 pGCAP10 NM_001101.3  
GGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCCCGT
HKR175277 ARi38D05 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR175306 ARi38E10 pGCAP10 NM_001101.3  
TGACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGC
HKR175610 ARi39A10 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR175656 ARi39C08 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR056411 ARe41A11 pKA1U5 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR056477 ARe41D05 pKA1U5 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR056525 ARe41F05 pKA1U5 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR056802 ARe42A02 pKA1U5 NM_001101.3  
ATCCTGGACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCC
HKR056850 ARe42C02 pKA1U5 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR056879 ARe42D07 pKA1U5 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR057331 ARe43F11 pKA1U5 NM_001101.3  
GGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCCCGT
HKR057352 ARe43G08 pKA1U5 NM_001101.3  
TGTCCGCCGAGACCGCGTCCGCCCCGCGAGCACCCATTNANCGCCTTTGCCGATCCGCCG
HKR057377 ARe43H09 pKA1U5 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACACANTTNTCGCCTTTGCCGATCCGCCGC
HKR058102 ARe45E06 pKA1U5 NM_001101.3  
TGACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGC
HKR058923 ARe47F03 pKA1U5 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGTCTCGCCTTTGCCGATCCGCCGCC
HKR059350 ARe48G06 pKA1U5 NM_001101.3  
GACCGCNGAGACCGCGCTCCGCCCCGCGCAGNACNGCATTCTNGNCTTTGCCGATCCGCC
HKR059611 ARe49A11 pKA1U5 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR176852 ARi42C04 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR176905 ARi42E09 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR177304 ARi43E08 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR177612 ARi44A12 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR177673 ARi44D01 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR178478 ARi46D06 pGCAP10 NM_001101.3  
TGACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGC
HKR179202 ARi48A02 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR179330 ARi48F10 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR061750 ARe54G06 pKA1U5 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR061751 ARe54G07 pKA1U5 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR062477 ARe56D05 pKA1U5 NM_001101.3  
GACCGCCGAAGACCGCGNTCCGCCCCGCGAGCACANCAGTTNTCGCCTTTGCCGATCCGC
HKR062924 ARe57F04 pKA1U5 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR063329 ARe58F09 pKA1U5 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR180073 ARi50D01 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR180079 ARi50D07 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR180571 ARi51H03 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR181235 ARi53B11 pGCAP10 NM_001101.3  
ACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCCC
HKR181302 ARi53E06 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR181657 ARi54C09 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR181682 ARi54D10 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR183203 ARi58A03 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR183377 ARi58H09 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR064411 ARe61A11 pKA1U5 NM_001101.3  
TGGACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGTAGNCTCGCCTTTGCCGATCCGCC
HKR064899 ARe62E03 pKA1U5 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR064973 ARe62H05 pKA1U5 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR065633 ARe64B09 pKA1U5 NM_001101.3  
GACNGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGNCTCGCCTTNGNCGATCCGCCGCC
HKR065657 ARe64C09 pKA1U5 NM_001101.3  
GGCCGAGACCGCGNTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCCCG
HKR065702 ARe64E06 pKA1U5 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR066012 ARe65A12 pKA1U5 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGNCTCGCCTTTGCCGATCCGCCGCC
HKR066056 ARe65C08 pKA1U5 NM_001101.3  
ATCCTGGACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCC
HKR066548 ARe66G04 pKA1U5 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR066948 ARe67G04 pKA1U5 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR067349 ARe68G05 pKA1U5 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR184080 ARi60D08 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR184175 ARi60H07 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR184500 ARi61E04 pGCAP10 NM_001101.3  
GCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCCCG
HKR184504 ARi61E08 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR184530 ARi61F10 pGCAP10 NM_001101.3  
CGGCCGGCCGATGACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGC
HKR184901 ARi62E05 pGCAP10 NM_001101.3  
TGACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGC
HKR184946 ARi62G02 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR185726 ARi64F06 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR186049 ARi65C01 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR186080 ARi65D08 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR186129 ARi65F09 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR186427 ARi66B03 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR186474 ARi66D02 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR186547 ARi66G03 pGCAP10 NM_001101.3  
TGACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGC
HKR187723 ARi69F03 pGCAP10 NM_001101.3  
GGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCCCGT
HKR068405 ARe71A05 pKA1U5 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR068428 ARe71B04 pKA1U5 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR068852 ARe72C04 pKA1U5 NM_001101.3  
ATCCTGGACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCC
HKR069306 ARe73E10 pKA1U5 NM_001101.3  
ATCCTGACCGCCGAGACCGCGTCCGCCCCGCGAGCANAGAGCCTCGCCTTTGCCGATCCG
HKR069748 ARe74G04 pKA1U5 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGNCTCGCCTTTGCCGATCCGCCGCC
HKR070124 ARe75F04 pKA1U5 NM_001101.3  
GACCGCCGAGACCGCGTTCCGCCCCGCGAGCACACCAGTTTTCGCCTTTGCCGATCCGCC
HKR070174 ARe75H06 pKA1U5 NM_001101.3  
ATCCTGTGACCGCCGAGACCGCGTCCGCCCCGCNAGTTACAGAGCCTCGCCTTTGCCGAT
HKR070880 ARe77D08 pKA1U5 NM_001101.3  
GACCGCCGAGACCGCGTTCCGCCCCGCGAGCACANAGTTNATCGCCTTTGCCGATCCGCC
HKR071227 ARe78B03 pKA1U5 NM_001101.3  
ATCCTGGACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCC
HKR188578 ARi71H10 pGCAP10 NM_001101.3  
TGACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGC
HKR072408 ARe81A08 pKA1U5 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR072451 ARe81C03 pKA1U5 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR072835 ARe82B11 pKA1U5 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR073260 ARe83C12 pKA1U5 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR074527 ARe86F07 pKA1U5 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR074874 ARe87D02 pKA1U5 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR075606 ARe89A06 pKA1U5 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR075754 ARe89G10 pKA1U5 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR076155 ARe90G11 pKA1U5 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR076925 ARe92F05 pKA1U5 NM_001101.3  
GACCGCCGAGACCGCGTTCCGCCCCGCGAGCACAGCAGCCTCGCCTTTGCCGATCCGCCG
HKR077209 ARe93A09 pKA1U5 NM_001101.3  
GACCGCCGAGACCGCNNTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATNCGCCGC
HKR077604 ARe94A04 pKA1U5 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR077725 ARe94F05 pKA1U5 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR078105 ARe95E09 pKA1U5 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR078454 ARe96C06 pKA1U5 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR079282 ARe98D10 pKA1U5 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR079682 ARe99D10 pKA1U5 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR203355 ARiS008G11 pGCAP10 NM_001101.3  
GGCCGAGACCGCNNCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCCCGT
HKR203382 ARiS008H14 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR203407 ARiS008I15 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR203451 ARiS008K11 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR205530 ARiS013N18 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR208031 ARiS020B07 pGCAP10 NM_001101.3  
ACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCCC
HKR208128 ARiS020F08 pGCAP10 NM_001101.3  
GGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCCCGT
HKR208257 ARiS020K17 pGCAP10 NM_001101.3  
GGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCCCGT
HKR208336 ARiS020N24 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR208339 ARiS020O03 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR208373 ARiS020P13 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR209208 ARiS023A08 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR209246 ARiS023B22 pGCAP10 NM_001101.3  
CGGCCGGCCGATGACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGC
HKR209323 ARiS023F03 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR209344 ARiS023F24 pGCAP10 NM_001101.3  
TGGACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCG
HKR209348 ARiS023G04 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR209404 ARiS023I12 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR209489 ARiS023M01 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR209499 ARiS023M11 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR218214 ARiS045I22 pGCAP10 NM_001101.3  
GNCCGCCAANACCGNNTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR218322 ARiS045N10 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR218373 ARiS045P13 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR219659 ARiS049C11 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR219714 ARiS049E18 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR219940 ARiS049O04 pGCAP10 NM_001101.3  
GACCGCCNAGACCGCGTCCGCCCCNCGAGCACAGANCCTCGCCTTTGCCGATCCGCCNCC
HKR222107 ARiS055E11 pGCAP10 NM_001101.3  
GACCGCCNANNNNGCGTCCCCCCCGCGAGCACANAGCCTCGCCTTTGCCGATCCGCCGCC
HKR234128 ARiS085F08 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR234161 ARiS085G17 pGCAP10 NM_001101.3  
TCCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCCC
HKR234238 ARiS085J22 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR234346 ARiS085O10 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR234367 ARiS085P07 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR234868 ARiS087C20 pGCAP10 NM_001101.3  
GCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCCCGTC
HKR234892 ARiS087D20 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR235174 ARiS087P14 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR235324 ARiS088F04 pGCAP10 NM_001101.3  
GGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCCCGT
HKR235374 ARiS088H06 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR235489 ARiS088M01 pGCAP10 NM_001101.3  
GGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCCCGT
HKR238678 ARiS096L14 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR243633 ARiS109B09 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR243641 ARiS109B17 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR243962 ARiS109P02 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR247248 ARiS118B24 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR247270 ARiS118C22 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR247567 ARiS118P07 pGCAP10 NM_001101.3  
GGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCCCGT
HKR248822 ARiS122A22 pGCAP10 NM_001101.3  
CGGCCGGCCGATGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGAT
HKR248884 ARiS122D12 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR249061 ARiS122K21 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR249065 ARiS122L01 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR249084 ARiS122L20 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR249154 ARiS122O18 pGCAP10 NM_001101.3  
ACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCCC
HKR260019 ARiS150A19 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR264475 ARiS161D03 pGCAP10 NM_001101.3  
GGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCCCGT
HKR264525 ARiS161F05 pGCAP10 NM_001101.3  
GACCGCCNNNACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR264536 ARiS161F16 pGCAP10 NM_001101.3  
GACCGCCNNNACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR264551 ARiS161G07 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR264692 ARiS161M04 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR276409 ARiS191A09 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR276486 ARiS191D14 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR276631 ARiS191J15 pGCAP10 NM_001101.3  
CGGCCGGCCGATGACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGC
HKR276722 ARiS191N10 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR277820 ARiS194J04 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR277937 ARiS194O01 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR279227 ARiS198B03 pGCAP10 NM_001101.3  
ACCGCCGNGNCNGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTNGCCGNNNCGCCGCC
HKR279256 ARiS198C08 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR279381 ARiS198H13 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR279434 ARiS198J18 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR321769 RBb04H01 pKA1U5 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACACANTTTTCGCCTTTGCCGATCCGCCGC
HKR322851 RBb07C03 pKA1U5 NM_001101.3  
GGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCCCGT
HKR323260 RBb08C12 pKA1U5 NM_001101.3  
ACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCCC
HKR361604 RBd04A04 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR363258 RBd08C10 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR326906 RBb17E10 pKA1U5 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR327328 RBb18F08 pKA1U5 NM_001101.3  
ACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCCC
HKR364830 RBd12B06 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR367299 RBd18E03 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR367305 RBd18E09 pGCAP10 NM_001101.3  
TGACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGC
HKR330858 RBb27C10 pGCAP1 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR368010 RBd20A10 pGCAP10 NM_001101.3  
TGACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGC
HKR368131 RBd20F11 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR371225 RBd28B01 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR334922 RBb37F02 pGCAP1 NM_001101.3  
TTGACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCG
HKR374073 RBd35D01 pGCAP10 NM_001101.3  
TGACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGC
HKR374079 RBd35D07 pGCAP10 NM_001101.3  
HKR374104 RBd35E08 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR338409 RBb46A09 pGCAP1 NM_001101.3  
AAATGTGGATCGCCGAGACCGCGTCCGCCNCGNGAGNANANANNCTCGNCTTTGCCGATCC
HKR338809 RBb47A09 pGCAP1 NM_001101.3  
GATTGTTGANACNGNGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR376921 RBd42F01 pGCAP10 NM_001101.3  
GGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCCCGT
HKR377754 RBd44G10 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR342082 RBb55D10 pGCAP1 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGTAGCACAGAGCCTCGCCTTTGCCGATCCGCCGC
HKR383375 RBd58H07 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR387722 RBd69F02 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR348503 RBb71E07 pGCAP1 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR390505 RBd76E09 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR391323 RBd78F03 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR392098 RBd80E02 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR394553 RBd86G09 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR396034 RBd90B10 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR397231 RBd93B07 pGCAP10 NM_001101.3  
GGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCCCGT
HKR399353 RBd98G09 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR402802 RBdS007A02 pGCAP10 NM_001101.3  
TGACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGC
HKR402966 RBdS007G22 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR405260 RBdS013C12 pGCAP10 NM_001101.3  
GGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCCCGT
HKR405291 RBdS013D19 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR406012 RBdS015A12 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR408884 RBdS022D12 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR408974 RBdS022H06 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR409113 RBdS022N01 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR416084 RBdS040D12 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR420687 RBdS051L23 pGCAP10 NM_001101.3  
GCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCCCG
HKR420778 RBdS051P18 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR428038 RBdS070B14 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR430055 RBdS075C07 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR430218 RBdS075J02 pGCAP10 NM_001101.3  
GGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCCCGT
HKR430235 RBdS075J19 pGCAP10 NM_001101.3  
TGACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGC
HKR442048 RBdS105B24 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR442173 RBdS105H05 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR442253 RBdS105K13 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR444181 RBdS110H13 pGCAP10 NM_001101.3  
TTGACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCG
HKR452888 RBdS132D16 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR462503 RBdS156E07 pGCAP10 NM_001101.3  
GGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCCCGT
HKR470948 RBdS177G04 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
HKR475051 RBdS187K11 pGCAP10 NM_001101.3  
GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.05

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl