Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS051P18

Clone ID RBdS051P18
HP ID HP00053
Gene ID 60
Gene Symbol ACTB
Protein Name actin, beta
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001101.3
Length of RefSeq (bp) 1852
Chromosome 7p15-p12
Reference DDBJ accession
UniGene Hs.520640
5'-terminal sequence GACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCC
2011.08.28