Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ACLY

Gene ID (NCBI) 47
Gene Symbol ACLY
Protein Name ATP citrate lyase
Synonyms ACL|ATPCL|CLATP
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K01648)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY081050 IRAL002K10 pOTB7 BC006195 NM_198830 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR320459 RBb01C11 pKA1U5 NM_001096.2  
GGCTGGGGTGCTCCGGATTTTGCGGGGTTCGTCGGGCCTGTGGAAGAAGCGCCGCGCACG
HKR362903 RBd07E07 pGCAP10 NM_001096.2  
TGGCTGGGGTGCTCCGGATTTTGCGGGGTTCGTCGGGCCTGTGGAAGAAGCGCCGCGCAC
HKR324530 RBb11F10 pKA1U5 NM_001096.2  
GGCTGGGGTGCTCCGGATTTTGCGGGGTTCGTCNGGCCTGATGGAAGAAGCGCCGCGCAC
HKR327725 RBb19F05 pKA1U5 NM_001096.2  
GCTGGGGTGCTCCGGATTTTGCGGGGTTCGTCGGGCCTGTGGAAGAAGCGCCGCGCACGG
HKR369625 RBd24B01 pGCAP10 NM_001096.2  
GGCTGGGGTGCTCCGGATTTTGCGGGGTTCGTCGGGCCTGTGGAAGAAGCGCCGCGCACG
HKR375649 RBd39C01 pGCAP10 NM_001096.2  
GGCTGGGGTGCTCCGGATTTTGCGGGGTTCGTCGGGCCTGTGGAAGAAGCGCCGCGCACG
HKR382074 RBd55D02 pGCAP10 NM_001096.2  
GGCTGGGGTGCTCCGGATTTTGCGGGGTTCGTCGGGCCTGTGGAAGAAGCGCCGCGCACG
HKR393281 RBd83D09 pGCAP10 NM_001096.2  
GTGCTGGGGTGCTCCGGATTTTGCGGGGTTCGTCGGGCCTGTGGAAGAAGCGCCGCGCAC
HKR406268 RBdS015L04 pGCAP10 NM_001096.2  
AAAAAGCCGGATCCCGGGAAGCTACCGGCTGCTGGGGTGCTCCGGATTTTGCGGGGTTCG
HKR442282 RBdS105L18 pGCAP10 NM_001096.2  
GGGGGGTTCGTCGGGCCTGTGGAAGAAGCGCCGCGCACGGACTTCGGCAGAGACAGGTAG
HKR475097 RBdS187M09 pGCAP10 NM_001096.2  
GGCTGGGGTGCTCCGGATTTTGCGGGGTTCGTCGGGCCTGTGGAAGAAGCGCCGCGCACG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.22

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl