Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS015L04

Clone ID RBdS015L04
HP ID HP05169
Gene ID 47
Gene Symbol ACLY
Protein Name ATP citrate lyase
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001096.2
Length of RefSeq (bp) 4450
Chromosome 17q12-q21
Reference DDBJ accession
UniGene Hs.387567
5'-terminal sequence AAAAAGCCGGATCCCGGGAAGCTACCGGCTGCTGGGGTGCTCCGGATTTTGCGGGGTTCG
2011.08.28