Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ACAT2

Gene ID (NCBI) 39
Gene Symbol ACAT2
Protein Name acetyl-CoA acetyltransferase 2
Synonyms -
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K00626)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB14698 pSpCas9(BB)-2A-puro-ACAT2 sgRNA Expression vector of sgRNA for targeting human ACAT2 and Cas9.

RDB_org_170226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY080652 IRAL001K12 pOTB7 BC000408 NM_005891 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR169629 ARi24B05 pGCAP10 NM_005891.2  
GGCAGACGGCGGCAGGAGAAGCAAGATGAATGCAGGCTCAGATCCTGTGGTCATCGTCTC
HKR056905 ARe42E09 pKA1U5 NM_005891.2  
GGCGAGGAGGAGCTTTGCCTAGCTTGCAGGCAGCGCAGGGCAGACGGCGGCAGGAGAAGC
HKR062453 ARe56C05 pKA1U5 NM_005891.2  
GGAGGAGGAGCTTTGCCTAGCTTGCAGGCAGCGCNTNTAAGACGGCGGCAGGAGAAGCAA
HKR062521 ARe56F01 pKA1U5 NM_005891.2  
GCTCCTCCTTTTCCAAGCGGCTGCCGAAGATGGCNGATNATGCAGGTCCTGGTGCTTGAT
HKR180973 ARi52H05 pGCAP10 NM_005891.2  
GGCTTGCAGGCAGCGCAGGGCAGACGGCGGCAGGAGAAGCAAGATGAATGCAGGCTCAGA
HKR205560 ARiS013O24 pGCAP10 NM_005891.2  
GGGGGCTACCTCAGGTCCCGCCCGCGGCAGGCCTGTGGGCTGCGAGGAGGAGCTTTGCCT
HKR235378 ARiS088H10 pGCAP10 NM_005891.2  
GGCTTGCAGGCAGCGCAGGGCAGACGGCGGCAGGAGAAGCAAGATGAATGCAGGCTCAGA
HKR238734 ARiS096N22 pGCAP10 NM_005891.2  
ANCGCAGGGCAGACNGCGGCANGAGAAGCAAGATGAATGCAGGCTCAGATCCTGTGGTCA
HKR324812 RBb12A12 pKA1U5 NM_005891.2  
GCCCGCCCGCGGCAGGCCTGTGGGCTGCGAGGAGGAGCTTTGCCTAGCTTGCAGGCAGCG
HKR372925 RBd32F05 pGCAP10 NM_005891.2  
TGGGCGAGGAGGAGCTTTGCCTAGCTTGCAGGCAGCGCAGGGCAGACGGCGGCAGGAGAA
HKR373250 RBd33C02 pGCAP10 NM_005891.2  
GAGCCCCCGGCCCACGGCGGCAGGAGAACCACCATGACTGCAGGATCCGATCCTGTGGTC
HKR338084 RBb45D12 pGCAP1 NM_005891.2  
GCCCGCCCGCGGCAGGCCTGTGGGCTGCGAGGAGGAGCTTTGCCTAGCTTGCAGGCAGCG
HKR442004 RBdS105A04 pGCAP10 NM_005891.2  
GGGGCTGGGGTCGGGCTGTCACACAATGGCTAGAAGTCGTGACTTCGTCTCCTTCGTGCC
HKR452885 RBdS132D13 pGCAP10 NM_005891.2  
GAGGTCCCGCCCGCGGCAGGCCTGTGGGCTGCGAGGAGGAGCTTTGCCTAGCTTGCAGGC
HKR461873 RBdS154L09 pGCAP10 NM_005891.2  
GAGACGGCGGCAGGAGAAGCAAGATGAATGCAGGCTCAGATCCTGTGGTCATCGTCTCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.10.27

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_171016.pl