DNA Bank Top |  KEGG KO K00626 > 

RIKEN DNA Bank Human Resource - ACAT2

Gene ID NCBI Gene 39 |  KEGG hsa:39
Gene Symbol ACAT2
Protein Name acetyl-CoA acetyltransferase 2
Synonyms -

Link

Ortholog resource in our bank

  ACAT2


External database

human ACAT2

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB14698 pSpCas9(BB)-2A-puro-ACAT2 sgRNA Expression vector of sgRNA for targeting human ACAT2 and Cas9.    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080652 IRAL001K12 pOTB7 BC000408 NM_005891 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR056905 ARe42E09 pKA1U5 NM_005891.2  
GGCGAGGAGGAGCTTTGCCTAGCTTGCAGGCAGCGCAGGGCAGACGGCGGCAGGAGAAGC
HKR062453 ARe56C05 pKA1U5 NM_005891.2  
GGAGGAGGAGCTTTGCCTAGCTTGCAGGCAGCGCNTNTAAGACGGCGGCAGGAGAAGCAA
HKR062521 ARe56F01 pKA1U5 NM_005891.2  
GCTCCTCCTTTTCCAAGCGGCTGCCGAAGATGGCNGATNATGCAGGTCCTGGTGCTTGAT
HKR169629 ARi24B05 pGCAP10 NM_005891.2  
GGCAGACGGCGGCAGGAGAAGCAAGATGAATGCAGGCTCAGATCCTGTGGTCATCGTCTC
HKR180973 ARi52H05 pGCAP10 NM_005891.2  
GGCTTGCAGGCAGCGCAGGGCAGACGGCGGCAGGAGAAGCAAGATGAATGCAGGCTCAGA
HKR205560 ARiS013O24 pGCAP10 NM_005891.2  
GGGGGCTACCTCAGGTCCCGCCCGCGGCAGGCCTGTGGGCTGCGAGGAGGAGCTTTGCCT
HKR235378 ARiS088H10 pGCAP10 NM_005891.2  
GGCTTGCAGGCAGCGCAGGGCAGACGGCGGCAGGAGAAGCAAGATGAATGCAGGCTCAGA
HKR238734 ARiS096N22 pGCAP10 NM_005891.2  
ANCGCAGGGCAGACNGCGGCANGAGAAGCAAGATGAATGCAGGCTCAGATCCTGTGGTCA
HKR324812 RBb12A12 pKA1U5 NM_005891.2  
GCCCGCCCGCGGCAGGCCTGTGGGCTGCGAGGAGGAGCTTTGCCTAGCTTGCAGGCAGCG
HKR338084 RBb45D12 pGCAP1 NM_005891.2  
GCCCGCCCGCGGCAGGCCTGTGGGCTGCGAGGAGGAGCTTTGCCTAGCTTGCAGGCAGCG
HKR372925 RBd32F05 pGCAP10 NM_005891.2  
TGGGCGAGGAGGAGCTTTGCCTAGCTTGCAGGCAGCGCAGGGCAGACGGCGGCAGGAGAA
HKR373250 RBd33C02 pGCAP10 NM_005891.2  
GAGCCCCCGGCCCACGGCGGCAGGAGAACCACCATGACTGCAGGATCCGATCCTGTGGTC
HKR442004 RBdS105A04 pGCAP10 NM_005891.2  
GGGGCTGGGGTCGGGCTGTCACACAATGGCTAGAAGTCGTGACTTCGTCTCCTTCGTGCC
HKR452885 RBdS132D13 pGCAP10 NM_005891.2  
GAGGTCCCGCCCGCGGCAGGCCTGTGGGCTGCGAGGAGGAGCTTTGCCTAGCTTGCAGGC
HKR461873 RBdS154L09 pGCAP10 NM_005891.2  
GAGACGGCGGCAGGAGAAGCAAGATGAATGCAGGCTCAGATCCTGTGGTCATCGTCTCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2024.09.24

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl