Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS154L09

Clone ID RBdS154L09
HP ID HP00381
Gene ID 39
Gene Symbol ACAT2
Protein Name acetyl-Coenzyme A acetyltransferase 2
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_005891.2
Length of RefSeq (bp) 1567
Chromosome 6q25.3
Reference DDBJ accession
UniGene Hs.571037
5'-terminal sequence GAGACGGCGGCAGGAGAAGCAAGATGAATGCAGGCTCAGATCCTGTGGTCATCGTCTCGG
2011.08.28