Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ACADM

Gene ID (NCBI) 34
Gene Symbol ACADM
Protein Name acyl-CoA dehydrogenase, C-4 to C-12 straight chain
Synonyms ACAD1|MCAD|MCADH
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K00249)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY086539 IRAL016F19 pDNR-LIB BC005377 NM_000016 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR362897 RBd07E01 pGCAP10 NM_000016.4  
GACGGGCTCCAGTGGGCGGGACCAGAGGAGTCCCGCGTTCGGGGAGTATGTCAAGGCCGT
HKR470855 RBdS177C07 pGCAP10 NM_000016.4  
GACCAGAGGAGTCCCGCGTTCGGGGAGTATGTCAAGGCCGTGACCCGTGTATTATTGTCC
HKR474916 RBdS187E20 pGCAP10 NM_000016.4  
GATTGTCCGAGTGGCCGGAACGGGAGCCAACATGGCAGCGGGGTTCGGGCGATGCTGCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.07.20

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl