Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS177C07

Clone ID RBdS177C07
HP ID HP00186
Gene ID 34
Gene Symbol ACADM
Protein Name acyl-Coenzyme A dehydrogenase, C-4 to C-12 straight chain
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_000016.4
Length of RefSeq (bp) 2615
Chromosome 1p31
Reference DDBJ accession
UniGene Hs.445040
5'-terminal sequence GACCAGAGGAGTCCCGCGTTCGGGGAGTATGTCAAGGCCGTGACCCGTGTATTATTGTCC
2011.08.28