Prev. |  KEGG KO K06184 > 

RIKEN DNA Bank Human Resource - ABCF1

Gene ID NCBI Gene 23 |  KEGG hsa:23
Gene Symbol ABCF1
Protein Name ATP binding cassette subfamily F member 1
Synonyms ABC27|ABC50
Ortholog resource in our bank

  ABCF1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04937 SEREX clone NGO-Pr-9 (ID 603) #1 SEREX clone NGO-Pr-9 (ID 603) #1

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY013516 IRAK033N04 pBluescriptR BC034488 NM_001025091 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE089231 M01C023B07 pDONR221 MGC01-C04 BC034488 NM_001025091  
HGE089279 M01C023D07 pDONR221 MGC01-C04 BC034488 NM_001025091  
HGE089327 M01C023F07 pDONR221 MGC01-C04 BC034488 NM_001025091  
HGE089375 M01C023H07 pDONR221 MGC01-C04 BC034488 NM_001025091  
HGE089423 M01C023J07 pDONR221 MGC01-C04 BC034488 NM_001025091  
HGE089471 M01C023L07 pDONR221 MGC01-C04 BC034488 NM_001025091  
HGE089519 M01C023N07 pDONR221 MGC01-C04 BC034488 NM_001025091  
HGE089567 M01C023P07 pDONR221 MGC01-C04 BC034488 NM_001025091  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR461653 RBdS154C05 pGCAP10 NM_001025091.1  
GAGCTGTAACTGCCACCGCGATGCCGAAGGCGCCCAAGCAGCAGCCGCCGGAGCCCGAGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl