Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS154C05

Clone ID RBdS154C05
HP ID HP09209
Gene ID 23
Gene Symbol ABCF1
Protein Name ATP-binding cassette, sub-family F (GCN20), member 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001025091.1
Length of RefSeq (bp) 3474
Chromosome 6p21.33
Reference DDBJ accession
UniGene Hs.655285
5'-terminal sequence GAGCTGTAACTGCCACCGCGATGCCGAAGGCGCCCAAGCAGCAGCCGCCGGAGCCCGAGT
2011.08.28