RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - AARS1

Gene ID	NCBI Gene 16 \| KEGG hsa:16
Gene Symbol	AARS1
Protein Name	alanyl-tRNA synthetase 1
Synonyms	AARS\|CMT2N\|EIEE29

Ortholog resource in our bank

  AARS1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number	Name of Resource	Description
RDB13274	pUC-T7-EMCV-GST-AlaRS	EMCV IRES-dependent expression vector of human alanyl-tRNA synthetase

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	Sequence submitted (DDBJ)⁽¹⁾	CDS comparison
Catalog number	Clone name	Vector	Sequence submitted (DDBJ)⁽¹⁾	Refered (NCBI mRNA)	CDS status⁽²⁾
HGX004808	IRAK012A08	pCMV-SPORT6	BC011451	NM_001605	Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR209342	ARiS023F22	pGCAP10	NM_001605.2
HKR209342	GGGAATAGGTGCAGCGGGCCCTTGGCGGGGGACTCTGAGGGAGGAGCTGGGGACGGCGAC
HKR461601	RBdS154A01	pGCAP10	NM_001605.2
HKR461601	GGGGGGACTCTGAGGGAGGAGCTGGGGACGGCGACCCTAGGAGAGTTCTTTGGGGTGACT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl