Prev. |  KEGG KO K01872 > 

RIKEN DNA Bank Human Resource - AARS1

Gene ID NCBI Gene 16 |  KEGG hsa:16
Gene Symbol AARS1
Protein Name alanyl-tRNA synthetase 1
Synonyms AARS|CMT2N|EIEE29
Ortholog resource in our bank

  AARS1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB13274 pUC-T7-EMCV-GST-AlaRS EMCV IRES-dependent expression vector of human alanyl-tRNA synthetase

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX004808 IRAK012A08 pCMV-SPORT6 BC011451 NM_001605 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR209342 ARiS023F22 pGCAP10 NM_001605.2  
GGGAATAGGTGCAGCGGGCCCTTGGCGGGGGACTCTGAGGGAGGAGCTGGGGACGGCGAC
HKR461601 RBdS154A01 pGCAP10 NM_001605.2  
GGGGGGACTCTGAGGGAGGAGCTGGGGACGGCGACCCTAGGAGAGTTCTTTGGGGTGACT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.05.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl