Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS154A01

Clone ID RBdS154A01
HP ID HP00666
Gene ID 16
Gene Symbol AARS
Protein Name alanyl-tRNA synthetase
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001605.2
Length of RefSeq (bp) 3344
Chromosome 16q22
Reference DDBJ accession
UniGene Hs.315137
5'-terminal sequence GGGGGGACTCTGAGGGAGGAGCTGGGGACGGCGACCCTAGGAGAGTTCTTTGGGGTGACT
2011.08.28