Resource data sheet
Prev.
Please review the QC test results indicated by check icon below as well as clone information before placing your order.

pMK393 (mAID-mCherry2-BSD)

A plasmid for construction of C-terminal mAID-mCherry2-BSD tagging donors.

Catalog number RDB16821
Resource name pMK393 (mAID-mCherry2-BSD)
Clone info. A plasmid for construction of C-terminal mAID-mCherry2-BSD tagging donors.
Vector backbone pBluescript (plasmid)
Size of vector backbone 2.9 kb
Selectable markers Am^r (E. coli)
Gene/insert name Arabidopsis thaliana AtIAA17 cDNA Discosoma sp. RFP cDNA
Depositor|Developer Kanemaki, Masato |
Other clones in our bank

External Database
Arabidopsis thaliana AtIAA17 Discosoma sp. RFP

          Reference sequence
            

          Distribution information

          Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
          Terms and conditions set forth by the DEPOSITOR In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of literature designated by the DEPOSITOR is requested (Yesbolatova, A. et al., Methods pii: S1046-2023 (18), 30331-1, 2019). This DNA clone is used for academic research purpose only. This is not to be used on a commercial basis. For use of this DNA clone except for internal academic research, the RECIPIENT must contact a NIG license representative at chizai@nig.ac.jp.
          Ordering Please visit Information of Request for Distribution.[link] 
          Order form 
          [Credit Card Payment]  [Bank Transfer Payment]
          Exclusive MTA (Takara Bio USA, Inc. FPs, for use for not-for-profit academic purpose)[Link]
          Remarks
          The BIOLOGICAL RESOURCE is not provided to for-profit organization or for for-profit research by non-profit organizations. Please read the Exclusive MTA (Takara Bio USA, Inc. FPs, for use for not-for-profit academic purpose).
          Distribution information (domestic users) [open/close]


          Catalog # Resource name Shipping form Fee (non-profit org.)
          RDB16821 pMK393 (mAID-mCherry2-BSD) DNA solution

          Ordering Information [in Japanese] [in English]
          Please review the QC test results indicated by check icon below as well as clone information before placing your order.

          References and tips

          Electronic file

          Original reference

          original Yesbolatova, A., Generation of conditional auxin-inducible degron (AID) cells and tight control of degron-fused proteins using the degradation inhibitor auxinole. Methods pii: S1046-2023 (18) 30331-1 (2019). PMID 31026591.

          Further references such as user reports and related articles (go to bottom)

          Featured content

          Featured content Auxin Inducible Degron (AID) System (English text)
          Featured content Auxin Inducible Degron (AID) System (Japanese text)

          Sequence information

          RIKEN BRC has sequenced portions of this material for quality test.
          Please review the QC test results indicated by check icon as well as clone information before placing your order.

          Test sheet RDB16821_A8Lpp1-2.pdf check

          Nucleotide sequence of a portion of this resource (if available).

          Primer: pUC-M13_-100
          Region: Linker, mAID, mCherry2 5'
          Sequence file: RDB16821_A8Lpa.seq check
          >D06157B8_A8Lp_1_pUC-M13_-100_A01_01_ABI08.ab1
              1 GGTTGGCAAG GCGGAATTAG TTGGGTACGC CAGGGTTTTC CCAGTCACGA CGTTGTAAAA
             61 CGACGGCCAG TGAGCGCGCG TAATACGACT CACTATAGGG CGAATTGGAG CTCCCCGGGA
            121 TCCGGTGCAG GCGCCAAGGA GAAGAGTGCT TGTCCTAAAG ATCCAGCCAA ACCTCCGGCC
            181 AAGGCACAAG TTGTGGGATG GCCACCGGTG AGATCATACC GGAAGAACGT GATGGTTTCC
            241 TGCCAAAAAT CAAGCGGTGG CCCGGAGGCG GCGGCGTTCG TGAAGGTATC AATGGACGGA
            301 GCACCGTACT TGAGGAAAAT CGATTTGAGG ATGTATAAAG CTAGCATGGT GAGCAAGGGC
            361 GAGGAGGATA ACATGGCCAT CATCAAGGAG TTCATGCGCT TCAAGGTGCA CATGGAGGGC
            421 TCCGTGAACG GCCACGAGTT CGAGATCGAG GGCGAGGGCG AGGGCCGCCC CTACGAGGGC
            481 ACCCAGACCG CCAAGCTGAA GGTGACCAAG GGTGGCCCCC TGCCCTTCGC CTGGGACATC
            541 CTGTCCCCTC AGTTCATGTA CGGCTCCAAG GCCTACGTGA AGCACCCCGC CGACATCCCC
            601 GACTACTTGA AGCTGTCCTT CCCCGAGGGC TTCAATTGGG AGCGCGTGAT GAACTTCGAG
            661 GACGGCTGCG TGGTGACCGT GACCCAGGAC TCCTCCCTGC AGGACGGCGA GTTCATCTAC
            721 AAGGTGAAGC TGCGCGGCAC CAACTTCCCC TCCGACGGCC CCGTAATGCA GTGTCGTACC
            781 ATGGGCTGGG AGGCCTCCAC TGAGCGGATG TACCCCGAGG ACGGCGCCCT GAAGGGCGAG
            841 ATCAAGCAGA GGCTGAAGCT GAAGGACGGC GGCCACTACG ACGCTGAGGT CAAGACCACC
            901 TACAAGGCCA AGAAGCCCGT GCAGCTGCCC GGCGCCTACA ACGTCGACAT CAAGTTGGAC
            961 ATCCTTTCCC ACAACGAGGA CTACACCATC GTGGAACAGT ACGAACGCGC CGAGGGCCGC
           1021 CACTCCACCG GCGGCATGGA CGAGCTGTAC AAGTAATCTA GATACTGATC ATAATCAGCC
           1081 ATACCACATT TGTAGAGGTT TTACTTGCTT TAAAAAACTC CCCACACCTC CCCTGAACTG
           1141 AACAATAAAT GATGCATGTG GTGGTACTTG TATGCAGCTA TATGGTTACA ATTAAGCATT
          1201 AGCATTCCCC AAAAT
          //
          Primer: reverse
          Region: loxP-2, mouse PGK ter, BSD
          Sequence file: RDB16821_A8Lpb.seq check
          >D06157B8_A8Lp_1_reverse_B01_02_ABI08.ab1
              1 ACCCGCAAAT TAAACCTCAC TAAAGGGAAC AAAAGCTGGG TACCGGATCC TAGTGAACCT
             61 CTTCGAGGGA CCTAATAACT TCGTATAGCA TACATTATAC GAAGTTATAT TAAGGGTTCC
            121 GGATCTCGAC CAGCTTCTGA TGGAATTAGA ACTTGGCAAA ACAATACTGA GAATGAAGTG
            181 TATGTGGAAC AGAGGCTGCT GATCTCGTTC TTCAGGCTAT GAAACTGACA CATTTGGAAA
            241 CCACAGTACT TAGAACCACA AAGTGGGAAT CAAGAGAAAA ACAATGATCC CACGAGAGAT
            301 CTATAGATCT ATAGATCATG AGTGGGAGGA ATGAGCTGGC CCTTAATTTG GTTTTGCTTG
            361 TTTAAATTAT GATATCCAAC TATGAAACAT TATCATAAAG CAATAGTAAA GAGCCTTCAG
            421 TAAAGAGCAG GCATTTATCT AATCCCACCC CACCCCCACC CCCGTAGCTC CAATCCTTCC
            481 ATTCAAAATG TAGGTACTCT GTTCTCACCC TTCTTAACAA AGTATGACAG GAAAAACTTC
            541 CATTTTAGTG GACATCTTTA TTGTTTAATA GATCATCAAT TTCTGCATCC CGGGGATCTG
            601 ATATCATCGA TTAGCCCTCC CACACATAAC CAGAGGGCAG CAATTCACGA ATCCCAACTG
            661 CCGTCGGCTG TCCATCACTG TCCTTCACTA TGGCTTTGAT CCCAGGATGC AGATCGAGAA
            721 GCACCTGTCG GCACCGTCCG CAGGGGCTCA AGATGCCCCT GTTCTCATTT CCGATCGCGA
            781 CGATACAAGT CAGGTTGCCA GCTGCCGCAG CAGCAGCAGT GCCCAGCACC ACGAGTTCTG
            841 CACAAGGTCC CCCAGTAAAA TGATATACAT TGACACCAGT GAAGATGCGG CCGTCGCTAG
            901 AGAGAGCTGC GCTGGCGACG CTGTAGTCTT CAGAGATGGG GATGCTGTTG ATTGTAGCCG
            961 TTGCTCTTTC AATGAGGGTG GATTCTTCTT GAGACAAAGG CTTGGGCCAT GGTGGCTCGA
           1021 GATCTAGATG GATGCAGGTC GAAAGGCCCG GAGATGAGAA GAGGAGACAG CGCGGCAGAC
           1081 GTGCGCTTTT GAGCGGTGCA GATGCCGGGC CTCCGGAGGA CTTCGGGCGC GCCCGCCCTG
           1141 AGCCGGCCTG AGCCGGCCCC GGACCACCTC CAGCTCTGAG CAGAAGCGCA GGAGCAAGGC
          1201 TCGTGCTAA
          //
          Primer: PGK_N_rev
          Region: PGK pro, loxP-1, SV40p(A), mCherry2 3'
          Sequence file: RDB16821_A8Lpc.seq check
          >D06157B8_A8Lp_1_PGK_N_rev_C01_03_ABI08.ab1
              1 CGGTTGAAGC GCCTCCCTAC CCGGTAGAAT TTCGAGGTCG AGATCCTAAG CTTGGCTGGA
             61 CGTAAACTCC TCTTCAGACC TAATAACTTC GTATAGCATA CATTATACGA AGTTATATTA
            121 AGGGTTATTG AATATGATCG ACGCGTTAAG ATACATTGAT GAGTTTGGAC AAACCACAAC
            181 TAGAATGCAG TGAAAAAAAT GCTTTATTTG TGAAATTTGT GATGCTATTG CTTTATTTGT
            241 AACCATTATA AGCTGCAATA AACAAGTTAA CAACAACAAT TGCATTCATT TTATGTTTCA
            301 GGTTCAGGGG GAGGTGTGGG AGGTTTTTTA AAGCAAGTAA AACCTCTACA AATGTGGTAT
            361 GGCTGATTAT GATCAGTTAT CTAGATTACT TGTACAGCTC GTCCATGCCG CCGGTGGAGT
            421 GGCGGCCCTC GGCGCGTTCG TACTGTTCCA CGATGGTGTA GTCCTCGTTG TGGGAAAGGA
            481 TGTCCAACTT GATGTCGACG TTGTAGGCGC CGGGCAGCTG CACGGGCTTC TTGGCCTTGT
            541 AGGTGGTCTT GACCTCAGCG TCGTAGTGGC CGCCGTCCTT CAGCTTCAGC CTCTGCTTGA
            601 TCTCGCCCTT CAGGGCGCCG TCCTCGGGGT ACATCCGCTC AGTGGAGGCC TCCCAGCCCA
            661 TGGTACGACA CTGCATTACG GGGCCGTCGG AGGGGAAGTT GGTGCCGCGC AGCTTCACCT
            721 TGTAGATGAA CTCGCCGTCC TGCAGGGAGG AGTCCTGGGT CACGGTCACC ACGCCGCCGT
            781 CCTCGAAGTT CATCACGCGC TCCCAATTGA AGCCCTCGGG GAAGGACAGC TTCAAGTAGT
            841 CGGGGATGTC GGCGGGGTGC TTCACGTAGG CCTTGGAGCC GTACATGAAC TGAGGGGACA
            901 GGATGTCCCA GGCGAAGGGC AGGGGGCCAC CCTTGGTCAC CTTCAGCTTG GCGGTCTGGG
            961 TGCCCTCGTA GGGGCGGCCC TCGCCCTCGC CCTCGATCTC GAACTCGTGG CCGTTCACGG
           1021 AGCCCTCCAT GTGCACCTTG AAGCGCATGA ACTCCTTGAT GATGGCCATG TTATCCTCCT
           1081 CGCCTGCTCA CATGCTAGCT TTATACATCC TCAAATCGAT TTTCTCAGTA CGGTGCTCGG
           1141 TTCCATTGAA TACGTCACGA CGCCGCCGGC CTCGGCAACG GCTTGGATTT GGGCAGGATC
          1201 ATACGTCTGC CGGATTGAAA TCTTACATCT TGTAAGT
          //
          Primer: PGKpro_F
          Region: PGK pro, BSD, mouse PGK ter
          Sequence file: RDB16821_A8Lpd.seq check
          > GGCGGCGGCCGGTTTCTCCTCTTCTCATCTCCGGGCCTTTCGACCTGCATCCATCTAGATCTCGAGCCACCATGGCCAAG
              1 CCTTTGTCTC AAGAAGAATC CACCCTCATT GAAAGAGCAA CGGCTACAAT CAACAGCATC
             61 CCCATCTCTG AAGACTACAG CGTCGCCAGC GCAGCTCTCT CTAGCGACGG CCGCATCTTC
            121 ACTGGTGTCA ATGTATATCA TTTTACTGGG GGACCTTGTG CAGAACTCGT GGTGCTGGGC
            181 ACTGCTGCTG CTGCGGCAGC TGGCAACCTG ACTTGTATCG TCGCGATCGG AAATGAGAAC
            241 AGGGGCATCT TGAGCCCCTG CGGACGGTGC CGACAGGTGC TTCTCGATCT GCATCCTGGG
            301 ATCAAAGCCA TAGTGAAGGA CAGTGATGGA CAGCCGACGG CAGTTGGGAT TCGTGAATTG
            361 CTGCCCTCTG GTTATGTGTG GGAGGGCTAA TCGATGATAT CAGATCCCCG GGATGCAGAA
            421 ATTGATGATC TATTAAACAA TAAAGATGTC CACTAAAATG GAAGTTTTTC CTGTCATACT
            481 TTGTTAAGAA GGGTGAGAAC AGAGTACCTA CATTTTGAAT GGAAGGATTG GAGCTACGGG
          541 GGTGGGGGTG GGGTGGGATT A
          //

          Please visit Sequencing and PCR primers for primer information.


          References

          Original, user report and related articles

          original Yesbolatova, A., Generation of conditional auxin-inducible degron (AID) cells and tight control of degron-fused proteins using the degradation inhibitor auxinole. Methods pii: S1046-2023 (18) 30331-1 (2019). PMID 31026591.

          2021.11.02

          GNP_filter3_RDBDEP_html_211029.pl