Resource data sheet
Prev.

pMK393 (mAID-mCherry2-BSD)

A plasmid for construction of C-terminal mAID-mCherry2-BSD tagging donors.

Catalog number RDB16821
Resource name pMK393 (mAID-mCherry2-BSD)
Clone info. A plasmid for construction of C-terminal mAID-mCherry2-BSD tagging donors.
Vector backbone pBluescript (plasmid)
Size of vector backbone 2.9 kb
Selectable markers Am^r (E. coli)
Gene/insert name Arabidopsis thaliana AtIAA17 cDNA Discosoma sp. RFP cDNA
Depositor Kanemaki, Masato |
 
Other clones in our bank Arabidopsis thaliana AXR3 (KEGG orthology K14484) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of literature designated by the DEPOSITOR is requested (Yesbolatova, A. et al., Methods pii: S1046-2023 (18), 30331-1, 2019). This DNA clone is used for academic research purpose only. This is not to be used on a commercial basis. For use of this DNA clone except for internal academic research, the RECIPIENT must contact a NIG license representative at chizai@nig.ac.jp.
Ordering Please visit Information of Request for Distribution. 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Exclusive MTA [Link]
Remarks
The BIOLOGICAL RESOURCE may not be used for COMMERCIAL PURPOSES. Please read the Exclusive MTA (Clontech FPs).
Distribution information (domestic users) [open/close]


Catalog # Resource name Shipping form Fee (non-profit org.)
RDB16821 pMK393 (mAID-mCherry2-BSD) DNA solution

Ordering Information [in Japanese] [in English]

References and tips

Electronic file

Original reference

original Yesbolatova, A., Generation of conditional auxin-inducible degron (AID) cells and tight control of degron-fused proteins using the degradation inhibitor auxinole. Methods pii: S1046-2023 (18) 30331-1 (2019). PMID 31026591.

Further references such as user reports and related articles (go to bottom)

Featured content

Featured content Auxin Inducible Degron (AID) System (English text)
Featured content Auxin Inducible Degron (AID) System (Japanese text)

Sequence information

RIKEN BRC has sequenced portions of this material for quality test. Primers and the results are shown below.

Data are summerized on test sheet below.

Test sheet RDB16821_A8Lpp1.pdf

Nucleotide sequence of a portion of this resource (if available).

Primer: pUC-M13_-100 RDB16821_A8Lpa.seq
>D06157B8_A8Lp_1_pUC-M13_-100_A01_01_ABI08.ab1
    1 GGTTGGCAAG GCGGAATTAG TTGGGTACGC CAGGGTTTTC CCAGTCACGA CGTTGTAAAA
   61 CGACGGCCAG TGAGCGCGCG TAATACGACT CACTATAGGG CGAATTGGAG CTCCCCGGGA
  121 TCCGGTGCAG GCGCCAAGGA GAAGAGTGCT TGTCCTAAAG ATCCAGCCAA ACCTCCGGCC
  181 AAGGCACAAG TTGTGGGATG GCCACCGGTG AGATCATACC GGAAGAACGT GATGGTTTCC
  241 TGCCAAAAAT CAAGCGGTGG CCCGGAGGCG GCGGCGTTCG TGAAGGTATC AATGGACGGA
  301 GCACCGTACT TGAGGAAAAT CGATTTGAGG ATGTATAAAG CTAGCATGGT GAGCAAGGGC
  361 GAGGAGGATA ACATGGCCAT CATCAAGGAG TTCATGCGCT TCAAGGTGCA CATGGAGGGC
  421 TCCGTGAACG GCCACGAGTT CGAGATCGAG GGCGAGGGCG AGGGCCGCCC CTACGAGGGC
  481 ACCCAGACCG CCAAGCTGAA GGTGACCAAG GGTGGCCCCC TGCCCTTCGC CTGGGACATC
  541 CTGTCCCCTC AGTTCATGTA CGGCTCCAAG GCCTACGTGA AGCACCCCGC CGACATCCCC
  601 GACTACTTGA AGCTGTCCTT CCCCGAGGGC TTCAATTGGG AGCGCGTGAT GAACTTCGAG
  661 GACGGCTGCG TGGTGACCGT GACCCAGGAC TCCTCCCTGC AGGACGGCGA GTTCATCTAC
  721 AAGGTGAAGC TGCGCGGCAC CAACTTCCCC TCCGACGGCC CCGTAATGCA GTGTCGTACC
  781 ATGGGCTGGG AGGCCTCCAC TGAGCGGATG TACCCCGAGG ACGGCGCCCT GAAGGGCGAG
  841 ATCAAGCAGA GGCTGAAGCT GAAGGACGGC GGCCACTACG ACGCTGAGGT CAAGACCACC
  901 TACAAGGCCA AGAAGCCCGT GCAGCTGCCC GGCGCCTACA ACGTCGACAT CAAGTTGGAC
  961 ATCCTTTCCC ACAACGAGGA CTACACCATC GTGGAACAGT ACGAACGCGC CGAGGGCCGC
 1021 CACTCCACCG GCGGCATGGA CGAGCTGTAC AAGTAATCTA GATACTGATC ATAATCAGCC
 1081 ATACCACATT TGTAGAGGTT TTACTTGCTT TAAAAAACTC CCCACACCTC CCCTGAACTG
 1141 AACAATAAAT GATGCATGTG GTGGTACTTG TATGCAGCTA TATGGTTACA ATTAAGCATT
1201 AGCATTCCCC AAAAT
//
Primer: reverse RDB16821_A8Lpb.seq
>D06157B8_A8Lp_1_reverse_B01_02_ABI08.ab1
    1 ACCCGCAAAT TAAACCTCAC TAAAGGGAAC AAAAGCTGGG TACCGGATCC TAGTGAACCT
   61 CTTCGAGGGA CCTAATAACT TCGTATAGCA TACATTATAC GAAGTTATAT TAAGGGTTCC
  121 GGATCTCGAC CAGCTTCTGA TGGAATTAGA ACTTGGCAAA ACAATACTGA GAATGAAGTG
  181 TATGTGGAAC AGAGGCTGCT GATCTCGTTC TTCAGGCTAT GAAACTGACA CATTTGGAAA
  241 CCACAGTACT TAGAACCACA AAGTGGGAAT CAAGAGAAAA ACAATGATCC CACGAGAGAT
  301 CTATAGATCT ATAGATCATG AGTGGGAGGA ATGAGCTGGC CCTTAATTTG GTTTTGCTTG
  361 TTTAAATTAT GATATCCAAC TATGAAACAT TATCATAAAG CAATAGTAAA GAGCCTTCAG
  421 TAAAGAGCAG GCATTTATCT AATCCCACCC CACCCCCACC CCCGTAGCTC CAATCCTTCC
  481 ATTCAAAATG TAGGTACTCT GTTCTCACCC TTCTTAACAA AGTATGACAG GAAAAACTTC
  541 CATTTTAGTG GACATCTTTA TTGTTTAATA GATCATCAAT TTCTGCATCC CGGGGATCTG
  601 ATATCATCGA TTAGCCCTCC CACACATAAC CAGAGGGCAG CAATTCACGA ATCCCAACTG
  661 CCGTCGGCTG TCCATCACTG TCCTTCACTA TGGCTTTGAT CCCAGGATGC AGATCGAGAA
  721 GCACCTGTCG GCACCGTCCG CAGGGGCTCA AGATGCCCCT GTTCTCATTT CCGATCGCGA
  781 CGATACAAGT CAGGTTGCCA GCTGCCGCAG CAGCAGCAGT GCCCAGCACC ACGAGTTCTG
  841 CACAAGGTCC CCCAGTAAAA TGATATACAT TGACACCAGT GAAGATGCGG CCGTCGCTAG
  901 AGAGAGCTGC GCTGGCGACG CTGTAGTCTT CAGAGATGGG GATGCTGTTG ATTGTAGCCG
  961 TTGCTCTTTC AATGAGGGTG GATTCTTCTT GAGACAAAGG CTTGGGCCAT GGTGGCTCGA
 1021 GATCTAGATG GATGCAGGTC GAAAGGCCCG GAGATGAGAA GAGGAGACAG CGCGGCAGAC
 1081 GTGCGCTTTT GAGCGGTGCA GATGCCGGGC CTCCGGAGGA CTTCGGGCGC GCCCGCCCTG
 1141 AGCCGGCCTG AGCCGGCCCC GGACCACCTC CAGCTCTGAG CAGAAGCGCA GGAGCAAGGC
1201 TCGTGCTAA
//
Primer: PGK_N_rev RDB16821_A8Lpc.seq
>D06157B8_A8Lp_1_PGK_N_rev_C01_03_ABI08.ab1
    1 CGGTTGAAGC GCCTCCCTAC CCGGTAGAAT TTCGAGGTCG AGATCCTAAG CTTGGCTGGA
   61 CGTAAACTCC TCTTCAGACC TAATAACTTC GTATAGCATA CATTATACGA AGTTATATTA
  121 AGGGTTATTG AATATGATCG ACGCGTTAAG ATACATTGAT GAGTTTGGAC AAACCACAAC
  181 TAGAATGCAG TGAAAAAAAT GCTTTATTTG TGAAATTTGT GATGCTATTG CTTTATTTGT
  241 AACCATTATA AGCTGCAATA AACAAGTTAA CAACAACAAT TGCATTCATT TTATGTTTCA
  301 GGTTCAGGGG GAGGTGTGGG AGGTTTTTTA AAGCAAGTAA AACCTCTACA AATGTGGTAT
  361 GGCTGATTAT GATCAGTTAT CTAGATTACT TGTACAGCTC GTCCATGCCG CCGGTGGAGT
  421 GGCGGCCCTC GGCGCGTTCG TACTGTTCCA CGATGGTGTA GTCCTCGTTG TGGGAAAGGA
  481 TGTCCAACTT GATGTCGACG TTGTAGGCGC CGGGCAGCTG CACGGGCTTC TTGGCCTTGT
  541 AGGTGGTCTT GACCTCAGCG TCGTAGTGGC CGCCGTCCTT CAGCTTCAGC CTCTGCTTGA
  601 TCTCGCCCTT CAGGGCGCCG TCCTCGGGGT ACATCCGCTC AGTGGAGGCC TCCCAGCCCA
  661 TGGTACGACA CTGCATTACG GGGCCGTCGG AGGGGAAGTT GGTGCCGCGC AGCTTCACCT
  721 TGTAGATGAA CTCGCCGTCC TGCAGGGAGG AGTCCTGGGT CACGGTCACC ACGCCGCCGT
  781 CCTCGAAGTT CATCACGCGC TCCCAATTGA AGCCCTCGGG GAAGGACAGC TTCAAGTAGT
  841 CGGGGATGTC GGCGGGGTGC TTCACGTAGG CCTTGGAGCC GTACATGAAC TGAGGGGACA
  901 GGATGTCCCA GGCGAAGGGC AGGGGGCCAC CCTTGGTCAC CTTCAGCTTG GCGGTCTGGG
  961 TGCCCTCGTA GGGGCGGCCC TCGCCCTCGC CCTCGATCTC GAACTCGTGG CCGTTCACGG
 1021 AGCCCTCCAT GTGCACCTTG AAGCGCATGA ACTCCTTGAT GATGGCCATG TTATCCTCCT
 1081 CGCCTGCTCA CATGCTAGCT TTATACATCC TCAAATCGAT TTTCTCAGTA CGGTGCTCGG
 1141 TTCCATTGAA TACGTCACGA CGCCGCCGGC CTCGGCAACG GCTTGGATTT GGGCAGGATC
1201 ATACGTCTGC CGGATTGAAA TCTTACATCT TGTAAGT
//
Primer: PGKpro_F RDB16821_A8Lpd.seq
> GGCGGCGGCCGGTTTCTCCTCTTCTCATCTCCGGGCCTTTCGACCTGCATCCATCTAGATCTCGAGCCACCATGGCCAAG
    1 CCTTTGTCTC AAGAAGAATC CACCCTCATT GAAAGAGCAA CGGCTACAAT CAACAGCATC
   61 CCCATCTCTG AAGACTACAG CGTCGCCAGC GCAGCTCTCT CTAGCGACGG CCGCATCTTC
  121 ACTGGTGTCA ATGTATATCA TTTTACTGGG GGACCTTGTG CAGAACTCGT GGTGCTGGGC
  181 ACTGCTGCTG CTGCGGCAGC TGGCAACCTG ACTTGTATCG TCGCGATCGG AAATGAGAAC
  241 AGGGGCATCT TGAGCCCCTG CGGACGGTGC CGACAGGTGC TTCTCGATCT GCATCCTGGG
  301 ATCAAAGCCA TAGTGAAGGA CAGTGATGGA CAGCCGACGG CAGTTGGGAT TCGTGAATTG
  361 CTGCCCTCTG GTTATGTGTG GGAGGGCTAA TCGATGATAT CAGATCCCCG GGATGCAGAA
  421 ATTGATGATC TATTAAACAA TAAAGATGTC CACTAAAATG GAAGTTTTTC CTGTCATACT
  481 TTGTTAAGAA GGGTGAGAAC AGAGTACCTA CATTTTGAAT GGAAGGATTG GAGCTACGGG
541 GGTGGGGGTG GGGTGGGATT A
//

Please visit Sequencing and PCR primers for primer information.


References

Original, user report and related articles

original Yesbolatova, A., Generation of conditional auxin-inducible degron (AID) cells and tight control of degron-fused proteins using the degradation inhibitor auxinole. Methods pii: S1046-2023 (18) 30331-1 (2019). PMID 31026591.

2019.07.12

GNP_filter3_RDBDEP_html_190431.pl