Resource data sheet
Please review the QC test results indicated by check icon below as well as clone information before placing your order.


Expression vector of sgRNA for right-target of mouse Tyr with hSpCas9-Cdt1(mouse) fusion protein.

Catalog number RDB14413
Resource name px330-mC-Tyr-R
Clone info. Expression vector of sgRNA for right-target of mouse Tyr (5'AAGTGAGATAGATCCCGTCT3') with hSpCas9-Cdt1(mouse) fusion protein (aa29-132, fused to Cas9 C-terminus).
Vector backbone pX330-U6-Chimeric_BB-CBh-hSpCas9 (plasmid)
Size of vector backbone 8.5 kb
Selectable markers Ampicillin
Gene/insert name mouse Cdt1 cDNA mouse Tyr genomic S. pyogenes Cas9 3xFLAG,SV40NLS,nucleospolin NLS
Depositor|Developer Sugiyama, Fumihiro | Mizuno, Seiya |
Other clones in our bank mouse Cdt1 (NCBI Gene 67177) | mouse Tyr (NCBI Gene 22173) | S. pyogenes (KEGG orthology K09952) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature designated by the DEPOSITOR is requested (Mizuno-Iijima, S. et al., Methods 191: 23-31 (2021)).
Ordering Please visit Information of Request for Distribution.[link] 
Order form 
[Credit Card Payment]  [Bank Transfer Payment]
Exclusive MTA (For the DNA materials containing CRISPR/Cas9 technologies and for not-for-profit academic purpose) [Word]
The BIOLOGICAL RESOURCE is not provided to for-profit organization or for for-profit research by non-profit organizations. Please refer the Exclusive MTA (For the DNA materials containing CRISPR/Cas9 technologies and for not-for-profit academic purpose).
Distribution information (domestic users) [open/close]

Catalog # Resource name Availability Shipping form Fee (non-profit org.)
RDB14413 px330-mC-Tyr-R Under QC test. Please contact us. DNA solution

check Please wait for results of QC test to be uploaded. This clone will be sequenced a portion for examination.
Ordering Information [in Japanese] [in English]

References and tips

Electronic file

Original reference

Further references such as user reports and related articles (go to bottom)

Featured content

Sequence information

check Please wait for results of QC test to be uploaded. This clone will be sequenced a portion for examination.


Original, user report and related articles
