Resource data sheet

pT7-gRNA:kit^h -2-2 DR274

Plasmid clone for in vitro transcription of sgRNA targeting rat Kit gene by Cas9.

Catalog number RDB13015
Resource name pT7-gRNA:kit^h -2-2 DR274
Alternative name Kit2-2
Clone info. Plasmid clone for in vitro transcription of sgRNA targeting rat Kit gene by Cas9.
Nucleotide sequence: 5' TAGGGTCAAGATGTCATCTTACGG 3'.
Vector backbone DR274 (Plasmid)
Size of vector backbone 2.2 kb
Gene/insert name Rat kit genomic DNA
Depositor Mashimo, Tomoji |
Other clones in our bank Rat Kit (KEGG orthology K05091) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested (Nat Commun. 5:4240, 2014).
Ordering Please visit Information of Request for Distribution. 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA) [Word]
Distribution information (domestic users) [open/close]

Catalog # Resource name Shipping form Fee (non-profit org.)
RDB13015 pT7-gRNA:kit^h -2-2 DR274 DNA solution

Ordering Information [in Japanese] [in English]

References and tips

Electronic file

Featured content

Featured content Genome Editing (English text)
Featured content Genome Editing (Japanese text)


original Yoshimi, K., Allele-specific genome editing and correction of disease-associated phenotypes in rats using the CRISPR-Cas platform. Nat. Commun. 5:4240 (2014). PMID 24967838.

User reports and related articles (go to bottom)

Sequence information

This clone will be sequenced a portion and digested by restriction enzyme for examination.



original Yoshimi, K., Allele-specific genome editing and correction of disease-associated phenotypes in rats using the CRISPR-Cas platform. Nat. Commun. 5:4240 (2014). PMID 24967838.
