Resource data sheet
Please review the QC test results indicated by check icon below as well as clone information before placing your order.

pT7-gRNA:Asip^a DR274

Plasmid clone for in vitro transcription of sgRNA targeting rat Asip gene by Cas9.

Catalog number RDB13012
Resource name pT7-gRNA:Asip^a DR274
Alternative name Asip
Clone info. Plasmid clone for in vitro transcription of sgRNA targeting rat Asip gene by Cas9.
Nucleotide sequence: 5' TAGGATGACAGGAGTCTAACTCAC 3'.
Vector backbone DR274 (Plasmid)
Size of vector backbone 2.2 kb
Gene/insert name Rat Asip genomic DNA
Depositor|Developer Mashimo, Tomoji |
Other clones in our bank Rat Asip (KEGG orthology K08725) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested (Nat Commun. 5:4240, 2014).
Ordering Please visit Information of Request for Distribution.[link] 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA for use for not-for-profit academic purpose) [Word]
Distribution information (domestic users) [open/close]

Catalog # Resource name Availability Shipping form Fee (non-profit org.)
RDB13012 pT7-gRNA:Asip^a DR274 Under QC test. Please contact us. DNA solution

check Please wait for results of QC test to be uploaded. This clone will be sequenced a portion for examination.
Ordering Information [in Japanese] [in English]

References and tips

Electronic file

Original reference

original Yoshimi, K., Allele-specific genome editing and correction of disease-associated phenotypes in rats using the CRISPR-Cas platform. Nat. Commun. 5:4240 (2014). PMID 24967838.

Further references such as user reports and related articles (go to bottom)

Featured content

Featured content Genome Editing (English text)
Featured content Genome Editing (Japanese text)

Sequence information

check Please wait for results of QC test to be uploaded. This clone will be sequenced a portion for examination.


Original, user report and related articles

original Yoshimi, K., Allele-specific genome editing and correction of disease-associated phenotypes in rats using the CRISPR-Cas platform. Nat. Commun. 5:4240 (2014). PMID 24967838.
