Plasmid clone for in vitro transcription of sgRNA targeting rat Asip gene by Cas9.
| Catalog number | RDB13012 |
|---|---|
| Resource name | pT7-gRNA:Asip^a DR274 |
| Alternative name | Asip |
| Clone info. | Plasmid clone for in vitro transcription of sgRNA targeting rat Asip gene by Cas9. Nucleotide sequence: 5' TAGGATGACAGGAGTCTAACTCAC 3'. |
| Vector backbone | DR274 (Plasmid) |
| Size of vector backbone | 2.2 kb |
| Gene/insert name | Rat Asip genomic DNA |
| Depositor | Mashimo, Tomoji | |
| Other clones in our bank | Rat Asip (KEGG orthology K08725) | |
Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
| Terms and conditions set forth by the DEPOSITOR | In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested (Nat Commun. 5:4240, 2014). |
|---|---|
| Ordering | Please visit Information of Request for Distribution. Order form [Credit Card Payment] [Bank Transfer or Check Payment] Material Transfer Agreement (MTA) [Word] |
[open/close]| Catalog # | Resource name | Shipping form | Fee (non-profit org.) |
|---|---|---|---|
| RDB13012 | pT7-gRNA:Asip^a DR274 | DNA solution |
Electronic file
Featured content
| Featured content | Genome Editing (English text) |
|---|---|
| Featured content | Genome Editing (Japanese text) |
References
| original | Yoshimi, K., Allele-specific genome editing and correction of disease-associated phenotypes in rats using the CRISPR-Cas platform. Nat. Commun. 5:4240 (2014). PMID 24967838. |
|---|
User reports and related articles (go to bottom)
This clone will be sequenced a portion and digested by restriction enzyme for examination.
References
| original | Yoshimi, K., Allele-specific genome editing and correction of disease-associated phenotypes in rats using the CRISPR-Cas platform. Nat. Commun. 5:4240 (2014). PMID 24967838. |
|---|
2018.12.11
GNP_filter3_RDBDEP_html_181012.pl