Plasmid clone for in vitro transcription of sgRNA targeting rat Asip gene by Cas9.
Catalog number | RDB13012 |
---|---|
Resource name | pT7-gRNA:Asip^a DR274 |
Alternative name | Asip |
Clone info. | Plasmid clone for in vitro transcription of sgRNA targeting rat Asip gene by Cas9. Nucleotide sequence: 5' TAGGATGACAGGAGTCTAACTCAC 3'. |
Vector backbone | DR274 (Plasmid) |
Size of vector backbone | 2.2 kb |
Gene/insert name | Rat Asip genomic DNA |
Depositor|Developer | Mashimo, Tomoji | |
  | |
Other clones in our bank | Rat Asip (KEGG orthology K08725) | |
Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR | In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested (Nat Commun. 5:4240, 2014). |
---|---|
Ordering | Please visit Information of Request for Distribution.[link] Order form [Credit Card Payment ![]() ![]() Material Transfer Agreement (MTA for use for not-for-profit academic purpose) [Word ![]() |
Catalog # | Resource name | Availability | Shipping form | Fee (non-profit org.) |
---|---|---|---|---|
RDB13012 | pT7-gRNA:Asip^a DR274 | Under QC test. Please contact us. | DNA solution |
Electronic file
Original reference
original | Yoshimi, K., Allele-specific genome editing and correction of disease-associated phenotypes in rats using the CRISPR-Cas platform. Nat. Commun. 5:4240 (2014). PMID 24967838. |
---|
Further references such as user reports and related articles (go to bottom)
Featured content
Featured content | Genome Editing (English text) |
---|---|
Featured content | Genome Editing (Japanese text) |
Please wait for results of QC test to be uploaded. This clone will be sequenced a portion for examination.
Original, user report and related articles
original | Yoshimi, K., Allele-specific genome editing and correction of disease-associated phenotypes in rats using the CRISPR-Cas platform. Nat. Commun. 5:4240 (2014). PMID 24967838. |
---|
2021.03.25
GNP_filter3_RDBDEP_html_210308.pl