Resource data sheet
Please review the QC test results indicated by check icon below as well as clone information before placing your order.


Promoter collection, Human ESR1 promoter

Catalog number RDB07528
Resource name pGL4-phESR1
Alternative name U2843-3
Clone info. PCR amplified human ESR1 promoter sequence was inserted into a firefly luciferase vector. Cloned fragment: 151806130 to 151807567(NC_000006.12); relatively -1549 to -111, where +1 corresponds to 1 nt of NM_000125.3; relatively -1189 to +249, where +1 corresponds to 1 nt of NM_001122740.1.
PCR cloning, forward primer: TTGCTGGCCATAAAGGGAAA; reverse primer: CACTCCAGGCACAACTCGAT. Entire sequence of promoter region has not been confirmed.
Vector backbone pGL4.10 [Luc2] (Plasmid)
Selectable markers Amp^r
Gene/insert name Human RP1-130E4.1, DKFZp686N23123, ER, ESR, ESRA, Era, NR3A1 genomic DNA
Depositor|Developer DNA Bank, |
Other clones in our bank human ESR1 (NCBI Gene 2099) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR 1. The RECIPIENT agrees to use the BIOLOGICAL RESOURCE only for academic research in the non-profit organization.  2. In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.
Additional terms and conditions for distribution The use of the BIOLOGICAL RESOURCE is restricted to the academic researches conducted by non-profit organization. By using this material, the RECIPIENT agrees to be bound by the conditions of the limited use statement of the Promega Corporation.
Ordering Please visit Information of Request for Distribution.[link] 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA) [Word]
Distribution information (domestic users) [open/close]

Catalog # Resource name Shipping form Fee (non-profit org.)
RDB07528 pGL4-phESR1 DNA solution

Ordering Information [in Japanese] [in English]
Please review the QC test results indicated by check icon below as well as clone information before placing your order.

References and tips

Electronic file

Electronic file Remarks, protocol and/or map (pdf) RDB07528.pdf

Original reference

Further references such as user reports and related articles (go to bottom)

Featured content

Featured content Dnaconda's recommendation EXR0002j (Japanese text)
Featured content Promoter Collection (Firefly Luciferase) (English text)

Sequence information

RIKEN BRC has sequenced portions of this material for quality test.
Please review the QC test results indicated by check icon as well as clone information before placing your order.

Test sheet RDB12848_A4Im.pdf check

Nucleotide sequence of a portion of this resource (if available).

Primer: pGL4-4174F
Sequence file: RDB12848_A4Ima.seq check
Primer: pGL4-136R
Sequence file: RDB12848_A4Imb.seq check
1141 T

Please visit Sequencing and PCR primers for primer information.


Original, user report and related articles

user report Chiu, J.H., Screening to identify commonly used chinese herbs that affect ERBB2 and ESR1 gene expression using the human breast cancer MCF-7 cell line. Evid. Based Complement. Alternat. Med., 965486 (2014). PMID 24987437.
user report Noomhorm, N., In vitro and in vivo effects of xanthorrhizol on human breast cancer MCF-7 cells treated with tamoxifen. J. Pharmacol. Sci. 125 (4): 375-385 (2014). PMID 25141924.
