Resource data sheet
Prev.
Please review the QC test results indicated by check icon below as well as clone information before placing your order.

pCMFlag_hsJUNB

Expression vector of human JUNB.

Catalog number RDB07502
Resource name pCMFlag_hsJUNB
Alternative name SET-0057_4
Clone info. Expression vector of human JUNB. Expression has not yet been confirmed.
Protein expression has not been confirmed. PCR cloning, forward primer: atgtgcactaaaatggaacagc; reverse primer: TCAGAAGGCGTGTCCCTTGA.
Vector backbone pCMV_S-FLAG (Plasmid)
Selectable markers Amp^r (E. coli), Neo^r (mammalian cell)
Gene/insert name Human jun B proto-oncogene /JUNB cDNA
Depositor|Developer DNA Bank, |
 
Other clones in our bank human JUNB (NCBI Gene 3726) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR The RECIPIENT agrees to describe RIKEN BRC as the source of the MATERIAL in any publication.
Ordering Please visit Information of Request for Distribution.[link] 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA for use for not-for-profit academic purpose) [Word]
Distribution information (domestic users) [open/close]


Catalog # Resource name Shipping form Fee (non-profit org.)
RDB07502 pCMFlag_hsJUNB DNA solution

Ordering Information [in Japanese] [in English]
Please review the QC test results indicated by check icon below as well as clone information before placing your order.

References and tips

Electronic file

Original reference

Further references such as user reports and related articles (go to bottom)

Featured content


Sequence information

RIKEN BRC has sequenced portions of this material for quality test.
Please review the QC test results indicated by check icon as well as clone information before placing your order.

Test sheet RDB07502_A7Ipp1-2.pdf check

Nucleotide sequence of a portion of this resource (if available).

Primer: CMV_Forward
Region: CMV pro,FLAG,insert 5'
Sequence file: RDB07502_A7Ipa.seq check
>07502_07502_A7Ip_CMV-Forward_D11_11_ABI24.ab1
    1 TGTAAACTCC GCCCATTGAC GCAATGGGCG GTAGGCGTGT ACGGTGGGAG GTCTATATAA
   61 GCAGAGCTCT CTGGCTAACT AGAGAACCCA CTGCTTACTG GCTTATCGAA ATTAATACGA
  121 CTCACTATAG GGAGACCCAA GCTGAATTCA CCATGGACTA CAAGGACGAT GACGATAAGG
  181 CGGCCATGTG CACTAAAATG GAACAGCCCT TCTACCACGA CGACTCATAC ACAGCTACGG
  241 GATACGGCCG GGCCCCTGGT GGCCTCTCTC TACACGACTA CAAACTCCTG AAACCGAGCC
  301 TGGCGGTCAA CCTGGCCGAC CCCTACCGGA GTCTCAAAGC GCCTGGGGCT CGCGGACCCG
  361 GCCCAGAGGG CGGCGGTGGC GGCAGCTACT TTTCTGGTCA GGGCTCGGAC ACCGGCGCGT
  421 CTCTCAAGCT CGCCTCTTCG GAGCTGGAAC GCCTGATTGT CCCCAACAGC AACGGCGTGA
  481 TCACGACGAC GCCTACACCC CCGGGACAGT ACTTTTACCC CCGCGGGGGT GGCAGCGGTG
  541 GAGGTGCAGG GGGCGCAGGG GGCGGCGTCA CCGAGGAGCA GGAGGGCTTC GCCGACGGCT
  601 TTGTCAAAGC CCTGGACGAT CTGCACAAGA TGAACCACGT GACACCCCCC AACGTGTCCC
  661 TGGGCGCTAC CGGGGGGCCC CCGGCTGGGC CCGGGGGCGT CTACGCCGGC CCGGAGCCAC
  721 CTCCCGTTTA CACCAACCTC AGCAGCTACT CCCCAGCCTC TGCGTCCTCG GGAGGCGCCG
  781 GGGCTGCCGT CGGGACCGGG AGCTCGTACC CGACGACCAC CATCAGCTAC CTCCCACACG
  841 CGCCGCCCTT CGCCGGTGGC CACCCGGCGC AGCTGGGCTT GGGCCGCGGC GCCTCCACCT
  901 TCAAGGAGGA ACCGCAGACC GTGCCGGAGG CGCGCAGCCG GGACGCCACG CCGCCGGTGT
  961 CCCCCATCAA CATGGAAGAC CAAGAGCGCA TCAAAGTGGA GCGCAAGCGG GCTGCGGGAA
 1021 CCCGGCTGGC GGCCACCAAA GTGCCCGGAA GCGGAGCTGG GAGCGCAATC GCCGCGCCTG
 1081 CAGACAGGTG AAGACGCTCA TGCGAGACGC GGGGCTGGTC GAGTACCGCC CGGGCCCTCC
1141 ATCCGGGGAA GCCAAGTG
//
Primer: BGH_rev2
Region: bGHpA,insert 3'
Sequence file: RDB07502_A7Ipb.seq check
>07502_07502_A7Ip_BGH_rev2_E11_14_ABI24.ab1
    1 CCAAGTCGGG GTCAGAGCAC GGGGGAGGGG CAAACAACAG ATGGCTGGCA ACTAGAAGGC
   61 ACAGTCGAGG CTGATCAGCG AGCTCTAGCA TTTAGGTGAC ACTATAGAAT AGGGCCCTCT
  121 AGATGCATGC TCGAGCGGCC TCAGAAGGCG TGTCCCTTGA CCCCAAGCAG CAGCTGACAG
  181 CCGTTGCTGA CGTGGGTCAT GACCTTCTGT TTGAGCTGGG CCACCTGCTC CCGGAGGAGG
  241 CCGGCGGTAC TCGACAGCCC CGCGTTCTCG GCCTTGAGCG TCTTCACCTT GTCCTCCAGG
  301 CGCGCGATGC GCTCCAGCTT CCGCTTCCGG CACTTGGTGG CCGCCAGCCG GTTCCGCAGC
  361 CGCTTGCGCT CCACTTTGAT GCGCTCTTGG TCTTCCATGT TGATGGGGGA CACCGGCGGC
  421 GTGGCGTCCC GGCTGCGCGC CTCCGGCACG GTCTGCGGTT CCTCCTTGAA GGTGGAGGCG
  481 CCGCGGCCCA AGCCCAGCTG CGCCGGGTGG CCACCGGCGA AGGGCGGCGC GTGTGGGAGG
  541 TAGCTGATGG TGGTCGTCGG GTACGAGCTC CCGGTCCCGA CGGCAGCCCC GGCGCCTCCC
  601 GAGGACGCAG AGGCTGGGGA GTAGCTGCTG AGGTTGGTGT AAACGGGAGG TGGCTCCGGG
  661 CCGGCGTAGA CGCCCCCGGG CCCAGCCGGG GGCCCCCCGG TAGCGCCCAG GGACACGTTG
  721 GGGGGTGTCA CGTGGTTCAT CTTGTGCAGA TCGTCCAGGG CTTTGACAAA GCCGTCGGCG
  781 AAGCCCTCCT GCTCCTCGGT GACGCCGCCC CCTGCGCCCC CTGCACCTCC ACCGCTGCCA
  841 CCCCCGCGGG GGTAAAAGTA CTGTCCCGGG GGTGTAGGCG TCGTCGTGAT CACGCCGTTG
  901 CTGTTGGGGA CAATCAGGCG TTCCAGCTCC GAAGAGGCGA GCTTGAGAGA CGCGCCGGTG
  961 TCCGAGCCCT GACCAGAAAA GTAGCTGCCG CCACCGCCGC CCTCTGGGCC GGGTCCGCGA
 1021 GCCCCAGGCG CTTTGAGACT CCGGTAGGGG TCGGCCAGGT TGACCGCCCA GGCTCGGGTT
 1081 TCAGAGTTGT AGTCGTGTAG AGAGAGCACA CGGCCCGGTC GTATCCGGTA GCCTGTGTTA
1141 TGGATCGATC ATGGTAGATG ACTGTTTCCA A
//
Primer: SV40pro_F_V2
Region: NeoR
Sequence file: RDB07502_A7Ipc.seq check
>07502_07502_A7Ip_SV40pro_F_V2_F11_17_ABI24.ab1
    1 GGCGAAGCCT TTTTTGGAGC CTAGGCTTTT GCAAAAGCTC CCGGGAGCTT GGATATCCAT
   61 TTTCGGATCT GATCAAGAGA CAGGATGAGG ATCGTTTCGC ATGATTGAAC AAGATGGATT
  121 GCACGCAGGT TCTCCGGCCG CTTGGGTGGA GAGGCTATTC GGCTATGACT GGGCACAACA
  181 GACAATCGGC TGCTCTGATG CCGCCGTGTT CCGGCTGTCA GCGCAGGGGC GCCCGGTTCT
  241 TTTTGTCAAG ACCGACCTGT CCGGTGCCCT GAATGAACTG CAGGACGAGG CAGCGCGGCT
  301 ATCGTGGCTG GCCACGACGG GCGTTCCTTG CGCAGCTGTG CTCGACGTTG TCACTGAAGC
  361 GGGAAGGGAC TGGCTGCTAT TGGGCGAAGT GCCGGGGCAG GATCTCCTGT CATCTCACCT
  421 TGCTCCTGCC GAGAAAGTAT CCATCATGGC TGATGCAATG CGGCGGCTGC ATACGCTTGA
  481 TCCGGCTACC TGCCCATTCG ACCACCAAGC GAAACATCGC ATCGAGCGAG CACGTACTCG
  541 GATGGAAGCC GGTCTTGTCG ATCAGGATGA TCTGGACGAA GAGCATCAGG GGCTCGCGCC
  601 AGCCGAACTG TTCGCCAGGC TCAAGGCGCG CATGCCCGAC GGCGAGGATC TCGTCGTGAC
  661 CCATGGCGAT GCCTGCTTGC CGAATATCAT GGTGGAAAAT GGCCGCTTTT CTGGATTCAT
  721 CGACTGTGGC CGGCTGGGTG TGGCGGACCG CTATCAGGAC ATAGCGTTGG CTACCCGTGA
  781 TATTGCTGAA GAGCTTGGCG GCGAATGGGC TGACCGCTTC CTCGTGCTTT ACGGTATCGC
  841 CGCTCCCGAT TCGCAGCGCA TCGCCTTCTA TCGCCTTCTT GACGAGTTCT TCTGAGCGGG
  901 ACTCTGGGGG TTCGAAATGA CCGACCAAGC GACGCCCAAC CTGCCATCAC GAGATTTCGA
  961 TTCCCACCGC CGCCCTTCTA TGAAAGGTTG GGCTTCGGAA TCGTTTTTCC GGGACGCCGG
 1021 CTGGATGATC CCTCCAGCGC GGGGATCTCA TGCTGGAGTT CTTCGCCCAC CCCACTTGGT
 1081 TTATGCAGCT ATATGGTTAC AATAAGCCAT TAGCCATCAC TAATTTCCAC AAATAAAGGC
1141 ATTTTTTTCC ACCTTGACAA TA
//

Please visit Sequencing and PCR primers for primer information.


References

Original, user report and related articles


2021.02.24

GNP_filter3_RDBDEP_html_201222.pl