Resource data sheet
Prev.

pGL4-phPLAU

Promoter collection, Human PLAU promoter

Catalog number RDB07487
Resource name pGL4-phPLAU
Alternative name U2833-5
Clone info. Promoter collection. PCR amplified human PLAU promoter sequence was inserted into a firefly luciferase vector. Genomic DNA (73,909,783 - 73,911,185nt of NC_000010.11) corresponding to 1 to 85nt of NM_002658.4 and 1.3 kb up-stream was cloned.
F-primer: GGGTTCAAAATGACCCCAAG; R-primer: TGCGGGGACAGGTGGACCCT. Entire sequence of promoter region has not been confirmed.
Vector backbone pGL4.10 [Luc2] (Plasmid)
Selectable markers Amp^r
Gene/insert name Human plasminogen activator, urokinase genomic DNA
Depositor DNA Bank, |
 
Other clones in our bank human PLAU (NCBI Gene 5328) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.
Additional terms and conditions for distribution The use of the BIOLOGICAL RESOURCE is restricted to the academic researches conducted by non-profit organization. By using this material, the RECIPIENT agrees to be bound by the conditions of the limited use statement of the Promega Corporation.
Ordering Please visit Information of Request for Distribution. 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA) [Word]
Distribution information (domestic users) [open/close]


Catalog # Resource name Shipping form Fee (non-profit org.)
RDB07487 pGL4-phPLAU DNA solution

Ordering Information [in Japanese] [in English]

References and tips

Electronic file

Electronic file PDF RDB07487.pdf from Depositor

Featured content

Featured content Promoter Collection (Firefly Luciferase) (English text)

References

User reports and related articles (go to bottom)


Sequence information

RIKEN BRC has sequenced portions of this material for quality test. Primers and the results are shown below.

Data are summerized on test sheet below.

Test sheet RDB07487_A6Gep1.pdf

Nucleotide sequence of a portion of this resource (if available).

Primer: pGL4-4174F RDB07487_A6Gea.seq
>07487_07487_A6Ge_pGL4-4174F_F01_16.ab1
    1 AAGGGTCAGA CTTTCTCTGG CCTAACTGGC CGGTACCTGA GCTCGCTAGC CTCGAGGATG
   61 GGTTCAAAAT GACCCCAAGC CCTGGTTCCT GACACTAGGG GAAAGAGATG GGGGTGACAG
  121 AATCACAGAA TCCCTGCTAT GTTCCTCCAA GTGTGCCCAG AGATGCGTGT GTGTGTGTGT
  181 GTATACACAA ATGTCTGCTT ATCCTCAGGC AGGAAGGGTG GATGCAGTCA TTTACACATG
  241 GTCTGTTTTT CTGGAGGACA ATTTTATTTG ATAAACAATT GTTTCTATCT GAATAGAATA
  301 AACAAGGCTC TATGATGAAG TAAAACACTA AATACACATG CATTAAAAAA TGCATAATTA
  361 TCTTTTTGGA ATGGGCTATA CAGAGATGTG CTTTTTAAAA TGTTAAGAGT GTAAAAGGAC
  421 AAACAGTGAA AAATAAATCT TCCTCTTATT TTGTCCTCCA GTCTCCCAAT TCCTCTACTC
  481 AGAGGTGAGA ACAGAACTTC CACACCCTCC AGAACCTCCA CAGTTAGAAC TGTCTACATG
  541 TTTCCATTGT CTTTACTTTT ATTCTTGCCT GCACAAATAA ATGAATTGCT CATTATGGAA
  601 ACTTCCCAAA AGACCCGTTA ACACTTCAAT AGGAAGCACC AACAGTTTAT GCCCTAGGAC
  661 TTTGTTCCCA CAATCCTGTA ACATCATATC ACGACACCTA ACCCAATCCT TATCAAGCCC
  721 TGTCAAAAAC GGACTTTAAA CCAAGCTGCA AATTTTCAGT AATCTGGCCT TGCCTTTCCC
  781 CCTCTGATAG CACCATCAAA CAAACCCCCT TACTGCCGAA AGCAATAAGC CCGGCTTTGT
  841 TCCATCCACT GGTTGTGTTG GTGATATCTG GGGACTGCCA CTGAACAGAC GCACAGAGGG
  901 AGCCCCTACA GGCACGGGTT TTTCTGTCTG TGCTTCTGGG AGAGTATGTC TCGTACATTT
  961 TGTCGCGTTG ATGAAAGACT TCACAGCTCC ATCAGCTGCG GGCAAAGGGG TCTGGAGCAG
 1021 TCTTTCGCAG TTGGGGGCCC AGCGGGGGAA GAAGCTGCCA GAGCACCTGA ATTAGAGGAA
1081 CCCCCAGGGC AAGGGT
//
Primer: pGL4-136R RDB07487_A6Geb.seq
>07487_07487_A6Ge_pGL4-136R_G01_19.ab1
    1 GCTTAGTTTT GGCATCTTCA TGGTGGCTTT ACCAACAGTA CCGGATTGCC AAGCTTGGCC
   61 GCCGAGGCCA GATCTTGATT GCGGGGACAG GTGGACCCTG GCCCGGGCTC CGGGGCTGCG
  121 GTCTCCGCAC TGTGCTGCGA CCCGCGGCGC CTGCTCTATA TCAGGGCCCG CCCCGGCGCC
  181 GCCCCTCCCT CTCCCGCCCG GCTCCCTCCC CTGTCTTGCA GCGCTCAGCG ACCCGGACCC
  241 CGCGTGCTTC CGCAACGCTC ACAAAGATTT GGGGGAAGCG CGATCTCCAG CGGAGGGGAC
  301 CCAACAGCGT CTGGACTGAG GAATCGAGAG GCTTGTAAAT TCTCCGTGCT TCCTCCCATG
  361 CACCTGGCCG GGGGCCTGCC CCAGTGCAAG GAGTCCCCGA ATTGCAGAGA GGAGAGAAGG
  421 CGCACAGGAG ACTCTCTACC TCGCCCAGCT CTGAAGCCTC CTGGGGTCCT CTAATCAGTT
  481 CTTCTGCAAC TTCTCCCCGC TGGGCCCCAA CTTGCCTAAG ACTGCCTCAG ACCCCCTTGC
  541 CCGCAGCTGA TGGAGCTGTG AAGTCTTCAT CAACGCGACA AATGTACGAG ACATACTCTC
  601 CCAGAAGCAC AGACAGAAAA ACCCCTGCCT GTAGGGGCTC CCTCTGTGCG TCTGTTCAGT
  661 GGCAGTCCCC AGATATCACC AACACAACCA GTGGATGGAA CAAAGCCGGG CTTATTGCTT
  721 TCGGCAGTAA GGGGGTTTGT TTGATGGTGC TATCAGAGGG GGAAAGGCAA GGCCAGATTA
  781 CTGAAAATTT GCAGCTTGGT TTAAAGTCCG TTTTTGACAG GGCTTGATAA GGATTGGGTT
  841 AGGTGTCGTG ATATGATGTT ACAGGATTGT GGGAACAAAG TCCTAGGGCA TAAACTGTTG
  901 GTGCTTCCTA TTGAAGTGTT AACGGGTCTT TTGGGAAAGT TTCCATAATG AGCAAATTCA
  961 TTTATTTGTG CAGGCAAGAA TAAAAGTAAA GACATGGGAA ACATGGTAGA ACAGCTCTTA
 1021 CTGTTGGAGG ATCCTGAAGG GATGTGAAAG GTCTGATCTC ACATCTGAGT AGAGAACTTG
1081 GGGGAGAACT GG
//
Primer: pAxCALNL_F1 RDB07487_A6Gec.seq
>07487_07487_A6Ge_pAxCALNL_F1_H01_22.ab1
    1 TATTATCTTA TCATGTCTGC TCGAGCGGCC GGCCGCCCCG ACTCTAGAAT TATTACACGG
   61 CGATCTTGCC GCCCTTCTTG GCCTTAATGA GAATCTCGCG GATCTTGCGG GCGTCCAACT
  121 TGCCGGTCAG TCCTTTAGGC ACCTCGTCCA CGAACACAAC ACCACCGCGC AGCTTCTTGG
  181 CGGTTGTAAC CTGGCTGGCC ACATAGTCCA CGATCTCCTT CTCGGTCATG GTTTTACCGT
  241 GTTCCAGCAC GACGACTGCG GCGGGCAGCT CGCCGGCATC GTCGTCGGGC AGGCCGGCGA
  301 CCCCGGCGTC GAAGATGTTG GGGTGTTGCA GCAGGATGCT CTCCAGTTCG GCTGGGGCTA
  361 CCTGGTAGCC CTTGTATTTG ATCAGGCTCT TCAGCCGGTC CACGATGAAG AAGTGCTCGT
  421 CCTCGTCCCA GTAGGCGATG TCGCCGCTGT GCAGCCAGCC GTCCTTGTCG ATGAGAGCGT
  481 TTGTAGCCTC GGGGTTGTTA ACGTAGCCGC TCATGATCAT GGGGCCACGG ACGCACAGCT
  541 CGCCGCGCTG GTTCACACCC AGTGTCTTAC CGGTGTCCAA GTCCACCACC TTAGCCTCGA
  601 AGAAGGGCAC CACCTTGCCT ACTGCGCCAG GCTTGTCGTC CCCTTCGGGG GTGATCAGAA
  661 TGGCGCTGGT TGTTTCTGTC AGGCCGTAGC CCTGGCGGAT GCCTGGTAGG TGGAAGCGTT
  721 TGGCCACGGC CTCACCTACC TCCTTGCTGA GCGGCGCCCC GCCGCTGGCG ATCTCGTGCA
  781 AGTTGCTTAG GTCGTACTTG TCGATGAGAG TGCTCTTAGC GAAGAAGCTA AATAGTGTGG
  841 GCACCAGCAG GGCAGATTGA ATCTTATAGT CTTGCAAGCT GCGCAAGAAT AGCTCCTCCT
  901 CGAAGCGGTA CATGAGCACG ACCCGAAAGC CGCAGATCAA GTAGCCCAGC GTGGGTGAAA
  961 CATGCCGAAG CCGTGGTGAA ATGGGCACCA CGCTGAGGAT AGCGGTGTCG GGGATGATCT
 1021 GGTTGCCGGA GATGGGGTCG CGGGGCATGA CTGCATCCGG ACAACAAAGG CCGGATGGCC
1081 GGATTGAGCG GATAG
//

Please visit Sequencing and PCR primers for primer information.


References

References

user report Resmini, G., HMGA1 regulates the Plasminogen activation system in the secretome of breast cancer cells. Sci. Rep. 7 (1): 11768 (2017). PMID 28924209.

2018.12.10

GNP_filter3_RDBDEP_html_181012.pl