Resource data sheet
Please review the QC test results indicated by check icon below as well as clone information before placing your order.


Promoter collection, Human PLAU promoter

Catalog number RDB07487
Resource name pGL4-phPLAU
Alternative name U2833-5
Clone info. Promoter collection. PCR amplified human PLAU promoter sequence was inserted into a firefly luciferase vector. Genomic DNA (73,909,783 - 73,911,185nt of NC_000010.11) corresponding to 1 to 85nt of NM_002658.4 and 1.3 kb up-stream was cloned.
F-primer: GGGTTCAAAATGACCCCAAG; R-primer: TGCGGGGACAGGTGGACCCT. Entire sequence of promoter region has not been confirmed.
Vector backbone pGL4.10 [Luc2] (Plasmid)
Selectable markers Amp^r
Gene/insert name Human plasminogen activator, urokinase genomic DNA
Depositor DNA Bank, |
Other clones in our bank human PLAU (NCBI Gene 5328) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.
Additional terms and conditions for distribution The use of the BIOLOGICAL RESOURCE is restricted to the academic researches conducted by non-profit organization. By using this material, the RECIPIENT agrees to be bound by the conditions of the limited use statement of the Promega Corporation.
Ordering Please visit Information of Request for Distribution. 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA) [Word]
Distribution information (domestic users) [open/close]

Catalog # Resource name Shipping form Fee (non-profit org.)
RDB07487 pGL4-phPLAU DNA solution

Ordering Information [in Japanese] [in English]
Please review the QC test results indicated by check icon below as well as clone information before placing your order.

References and tips

Electronic file

Electronic file Remarks, protocol and/or map (pdf) RDB07487.pdf

Original reference

Further references such as user reports and related articles (go to bottom)

Featured content

Featured content Dnaconda's recommendation EXR0096e (English text)
Featured content Dnaconda's recommendation EXR0096j (Japanese text)
Featured content Promoter Collection (Firefly Luciferase) (English text)

Sequence information

RIKEN BRC has sequenced portions of this material for quality test.
Please review the QC test results indicated by check icon as well as clone information before placing your order.

Test sheet RDB07487_A6Gep1.pdf check

Nucleotide sequence of a portion of this resource (if available).

Primer: pGL4-4174F
Sequence file: RDB07487_A6Gea.seq check
Primer: pGL4-136R
Sequence file: RDB07487_A6Geb.seq check
Primer: pAxCALNL_F1
Sequence file: RDB07487_A6Gec.seq check

Please visit Sequencing and PCR primers for primer information.


Original, user report and related articles

user report Resmini, G., HMGA1 regulates the Plasminogen activation system in the secretome of breast cancer cells. Sci. Rep. 7 (1): 11768 (2017). PMID 28924209.
