Resource data sheet
Prev.
Please review the QC test results indicated by check icon below as well as clone information before placing your order.

pGL4-phSTAT1

Promoter collection, Human STAT1 promoter

Catalog number RDB07405
Resource name pGL4-phSTAT1
Alternative name U2766(2144)-10
Clone info. PCR amplified human STAT1 promoter sequence was inserted into a firefly luciferase vector. Cloned fragment: 191015482 to 191014170 (NC_000002.12); relatively -1232 to +81, where +1 corresponds to 1 nt of NM_007315.3.
PCR cloning, forward primer: AGGGGTTTTCCAAACTCAGG; reverse primer: ACTACCCGGCAGGAGAAAAG. Known differences: Compared with NC_000002.12, C to A substitution at 191,015,359nt, insertion of AA between 191,015,243 and 191,015,242nt, T to G substitution at 191,015,207nt, G to A substitution at 191,015,065nt, , G to A substitution at 191,014,834nt and A to G substitution at 191,014,691nt.
Vector backbone pGL4.10 [Luc2] (Plasmid)
Selectable markers Amp^r
Gene/insert name Human signal transducer and activator of transcription 1, 91kDa genomic DNA
Depositor|Developer DNA Bank, |
 
Other clones in our bank human STAT1 (NCBI Gene 6772) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.
Additional terms and conditions for distribution The use of the BIOLOGICAL RESOURCE is restricted to the academic researches conducted by non-profit organization. By using this material, the RECIPIENT agrees to be bound by the conditions of the limited use statement of the Promega Corporation.
Ordering Please visit Information of Request for Distribution.[link] 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA for use for not-for-profit academic purpose) [Word]
Distribution information (domestic users) [open/close]


Catalog # Resource name Shipping form Fee (non-profit org.)
RDB07405 pGL4-phSTAT1 DNA solution

Ordering Information [in Japanese] [in English]
Please review the QC test results indicated by check icon below as well as clone information before placing your order.

References and tips

Electronic file

Electronic file Remarks, protocol and/or map (pdf) RDB07405.pdf

Original reference

Further references such as user reports and related articles (go to bottom)

Featured content

Featured content Promoter Collection (Firefly Luciferase) (English text)

Sequence information

RIKEN BRC has sequenced portions of this material for quality test.
Please review the QC test results indicated by check icon as well as clone information before placing your order.

Test sheet RDB07405_A1Dip1-1.pdf check

Nucleotide sequence of a portion of this resource (if available).

Primer: pGL4-4174F
Region: pause site,insert 5'
Sequence file: RDB07405_A1Dia.seq check
>7405_pGL4-4174F_A04_01_2011-04-19-11-44-21.ab1
    1 AGTAGGGTCA GACATTTCTC TGGCCTAACT GGCCGGTACC TGAGCTCGCT AGCCTCGAGG
   61 ATAGGGGTTT TCCAAACTCA GGGTGAGAAG TCCCTGAGTT TGGAGAGTGT GGTTTATTTG
  121 AAGAACTAAA TGCTGAAGTA AGCAAAGCAG AGTGGCACAT TATGGGGTTG GACAAAGAGA
  181 TCGGGAAACC AGGGCTTTAT AGTATGTATT AAGAAACTGA ATTTTATAAG AGCAAAGAAA
  241 AGCCATGGAA GGATTTTCAG GTTGGCAAAT GACATGATCT GCTTTTCAAT TAAAAAAAAA
  301 AAAACACTCA AACTCTTGTA TGGAGAATGG ATTAAAAGGG AGATAAGGGC TGAAGTGAGG
  361 CAGCCATTCG GGAATCTACT GCAGAAGGAG GCAGCAGAAG AGATGGAGCA GAGTAAATGA
  421 GACTTGGGAA ATATTTAGGA GGAAGAATCA ATTAAGATTT GAGGATCAGG TGTTGCGAGG
  481 TAAGGGAGAA GGCAATGTCA ACTATGAATC CTAGGTATCT GTCATGTGCC ATTTCTAGAA
  541 AAAGAGCAGG TTTGAGGAGA AAGATGTTTG GTTCTGAACA TAGTTTGTAG AGCTCACTGC
  601 ACATACAAGT GGAGAGGCAA GTGGGAGTTG TAGGTGTGAA GCCCAGAGGA GAGGTGTGGA
  661 CGGGATAAGC ATTTAAGACT CCTCCATCTA GAAGGAAACT GAAGCTGTGG GTAAGGTCAT
  721 CACAGCACAG CGTTTAGGAG AAGCCCAGGT AAAGAAGCTG ACGAATGTCT GGACCCTGAC
  781 AACCTTAACA TATAATGGTT TGATAGTGGA GGTGGAGGCA ATGTAGAAAG AATGCCAGAG
  841 GCAGGAAAAA GCAAGGAGGA TGTGTTATCA TCATGACCAA GGAAGAAACG TGTTTCAAGA
  901 ACAAAGGCGT CAACTCTGCC CCATGCTTCC GAGCTGTCAA GTAAAGTGAG AAAAACAGAA
  961 AAGCGTTCCC TGGGTTTAGC AACACGGAGG TCAGTTGCTA AAGGGAGCTT CTAGAAATGA
 1021 CGACGTCGCC CAAATCTGTC TCTGCCTGGA TTCTCGGCGA TGAACCTACC TACAGAGACT
 1081 TCCAAAGTTT GGCATCTGCA AACACAGACA CGTCTTTCTG ATCGATTTCT CTTAAGGAAT
1141 ATG
//
Primer: pGL4-136R
Region: Luc 5', insert 3'
Sequence file: RDB07405_A1Dib.seq check
>7405_pGL4-136R_A04_01_2011-04-19-11-44-21.ab1
    1 GCTCCTAGGT TTTTGGCATC TTCCATGGTG GCTTTACCAA CAGTACCGGA TTGCCAAGCT
   61 TGGCCGCCGA GGCCAGATCT TGATACTACC CGGCAGGAGA AAAGGCAGCG CTGGCGCCCG
  121 GCCCCCTTCC GCCCCCACCA ATCACCGGGC GGCTCCGCGC TCAGCCAATT AGACGCGGCT
  181 GTTCCGTGGG CGCCACCGCC TCCCTCTGCG GGCCGCTGCT CCGCCCACGC GCTGGGGTAT
  241 TTCCGCCGGC TTCCGGCGGG GGCCGCCGGC TGGGTGAGCT GCAGCCCAGT CCCGTGTTGC
  301 CACGCTGGGA ACTGGCGTTC TGTTTACATA TCTTAGAGAA CGATCAGAAG GACGTGCTGT
  361 GTTTGCAGAA GCCCAAACTT GGAGGTCTCT GTAGTAGTTT CATCGCCGAG AATCCAGGCA
  421 GAGGACAGAT TTGGCGACGT CGTCATTCTA GAAGCTCCCT TTAGCAACTG ACCTCCGTGT
  481 TGCTAAACCC AGGGAACGCT TTTCTGTTTT TCTCACTTTA CTTGACAGCT CGGAAGCATG
  541 GGGCAGAGTT GACGCCTTTG TTCTTGAAAC ACGTTTCTTC CTTGGTCATG ATGATAACAC
  601 ATCCTCCTTG CTTTTTCCTG CCTCTGGCAT TCTTTCTACA TTGCCTCCAC CTCCACTATC
  661 AAACCATTAT ATGTTAAGGT TGTCAGGGTC CAGACATTCG TCAGCTTCTT TACCTGGGCT
  721 TCTCCTAAAC GCTGTGCTGT GATGACCTTA CCCACAGCTT CAGTTTCCTT CTAGATGGAG
  781 GAGTCTTAAA TGCTTATCCC GTCCACACCT CTCCTCTGGG CTTCACACCT ACAACTCCCA
  841 CTTGCCTCTC CACTTGTATG TGCAGTGAGC TCTACAAACT ATGTTCAGAA CCAAACATCT
  901 TTCTCCTCAA ACCTGCTCTT TTTCTAGAAA TGGCACATGA CAGATACCTA GGATTCATAG
  961 TTGACATTGC CTTCTCCCTT TACCTCGCAA CACCTGATCC TCAAATCTTT AATTTGATTC
 1021 TTCCTCCTAA ATATTTCCCA AGTCTCATTT ACTCTGCTCC ATCTCTTCTG CCTGGCTCGT
 1081 TCTGCAGTAG ATTCCCGATG GCTGCCTTCA CTCAGCCCGT ATCCTCCCGT TTTAATCCAT
1141 TCCTCTCCAT TACCA
//
Primer: SV40pA_R
Region: SV40 pA,Lec 3'
Sequence file: RDB07405_A1Dic.seq check
>07405_07405_B0L2F_SV40pA_R_A01_01_ABI08.ab1
    1 NNNNNNNNNN NNNATTTNNN AAATAAAGCA TTTTTTTCAC TGCATTCTAG TTGTGGTTTG
   61 TCCAAACTCA TCAATGTATC TTATCATGTC TGCTCGAAGC GGCCGGCCGC CCCGACTCTA
  121 GAATTATTAC ACGGCGATCT TGCCGCCCTT CTTGGCCTTA ATGAGAATCT CGCGGATCTT
  181 GCGGGCGTCC AACTTGCCGG TCAGTCCTTT AGGCACCTCG TCCACGAACA CAACACCACC
  241 GCGCAGCTTC TTGGCGGTTG TAACCTGGCT GGCCACATAG TCCACGATCT CCTTCTCGGT
  301 CATGGTTTTA CCGTGTTCCA GCACGACGAC TGCGGCGGGC AGCTCGCCGG CATCGTCGTC
  361 GGGCAGGCCG GCGACCCCGG CGTCGAAGAT GTTGGGGTGT TGCAGCAGGA TGCTCTCCAG
  421 TTCGGCTGGG GCTACCTGGT AGCCCTTGTA TTTGATCAGG CTCTTCAGCC GGTCCACGAT
  481 GAAGAAGTGC TCGTCCTCGT CCCAGTAGGC GATGTCGCCG CTGTGCAGCC AGCCGTCCTT
  541 GTCGATGAGA GCGTTTGTAG CCTCGGGGTT GTTAACGTAG CCGCTCATGA TCATGGGGCC
  601 ACGGACGCAC AGCTCGCCGC GCTGGTTCAC ACCCAGTGTC TTACCGGTGT CCNAGTCCAC
  661 CACCTTANCC TCNAANAANN GNCACCACCT TGNCTANTGC GCCNGGNTTG NCGTCCCNNT
721 NNGGGGNGAN NNNNNNNGNN NNNNGNNNNN
//

Please visit Sequencing and PCR primers for primer information.


References

Original, user report and related articles


2020.12.17

GNP_filter3_RDBDEP_html_201216.pl