Prev. |  KEGG KO K11220 > 

RIKEN DNA Bank Human Resource - STAT1

Gene ID NCBI Gene 6772 |  KEGG hsa:6772
Gene Symbol STAT1
Protein Name signal transducer and activator of transcription 1
Synonyms CANDF7|IMD31A|IMD31B|IMD31C|ISGF-3|STAT91
Featured content Jak-STAT signaling pathway (human)
Featured content Toll-like receptor signaling pathway - human
Featured content SARS-CoV-2 relevant human genes
Featured content Influenza A relevant genes - human
Ortholog resource in our bank

  STAT1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number Name of Resource Description
RDB06381 pCMFlag_hsSTAT1 Expression vector of human STAT1.
RDB07405 pGL4-phSTAT1 Promoter collection, Human STAT1 promoter

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY084804 IRAL012A04 pOTB7 BC002704 NM_139266 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE030218 W01A075J02 pENTR-TOPO flj0042b12 AK096686 NM_139266 done

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR049728 ARe24F08 pKA1U5 NM_007315.3  
GCTGCGCAGAGTCTGCGGAGGGGCTCGGCTGCACCGGGGGGATCGCGCCTGGCAGACCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl