Prev. | Human A to Z list > S > 

RIKEN DNA Bank Human Resource - STAT1

Gene ID (NCBI) 6772
Gene Symbol STAT1
Protein Name signal transducer and activator of transcription 1
Synonyms CANDF7|IMD31A|IMD31B|IMD31C|ISGF-3|STAT91
Databases KEGG hsa:6772 |  NCBI Gene 6772
Featured content Jak-STAT signaling pathway (human)
Featured content Toll-like receptor signaling pathway - human
Featured content Ortholog resources in the DNA Bank (KEGG orthology K11220)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB06381 pCMFlag_hsSTAT1 Expression vector of human STAT1
RDB07405 pGL4-phSTAT1 Promoter collection, Human STAT1 promoter

RDB_org_170226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY084804 IRAL012A04 pOTB7 BC002704 NM_139266 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE030218 W01A075J02 pENTR-TOPO flj0042b12 AK096686 NM_139266 done

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR049728 ARe24F08 pKA1U5 NM_007315.3  
GCTGCGCAGAGTCTGCGGAGGGGCTCGGCTGCACCGGGGGGATCGCGCCTGGCAGACCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.06.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl