Resource data sheet
Prev.

pGL4-phHLA-E

Promoter collection, Human HLA-E promoter

Catalog number RDB07388
Resource name pGL4-phHLA-E
Alternative name U2649 (2027)-3
Clone info. Promoter collection. PCR amplified human HLA-E promoter sequence was inserted into a firefly luciferase vector. Genomic DNA (30,488,373 - 30,489,534nt of NC_000006.12) corresponding to 1 to 129nt of NM_005516.5 and 1.0 kb up-stream was cloned.
F-primer: tctcagcctccagagttgct; R-primer: catgatcccagcctctgagt. Entire sequence of promoter region has not been confirmed. Known differences (at least): Insertion of A before 30,488,837nt of NC_000006.12.
Vector backbone pGL4.10 [Luc2] (Plasmid)
Selectable markers Amp^r
Gene/insert name Human major histocompatibility complex, class I, E genomic DNA
Depositor DNA Bank, |
 
Other clones in our bank human HLA-E (NCBI Gene 3133) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.
Additional terms and conditions for distribution The use of the BIOLOGICAL RESOURCE is restricted to the academic researches conducted by non-profit organization. By using this material, the RECIPIENT agrees to be bound by the conditions of the limited use statement of the Promega Corporation.
Ordering Please visit Information of Request for Distribution. 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA) [Word]
Distribution information (domestic users) [open/close]


Catalog # Resource name Shipping form Fee (non-profit org.)
RDB07388 pGL4-phHLA-E DNA solution

Ordering Information [in Japanese] [in English]

References and tips

Electronic file

Electronic file PDF RDB07388.pdf from Depositor

Featured content

Featured content Promoter Collection (Firefly Luciferase) (English text)

References

User reports and related articles (go to bottom)


Sequence information

RIKEN BRC has sequenced portions of this material for quality test. Primers and the results are shown below.

Data are summerized on test sheet below.

Test sheet RDB07388_A7Eop1.pdf

Nucleotide sequence of a portion of this resource (if available).

Primer: RDB07388#2 RDB07388_A7Eoa.seq
>07388_07388_A7Eo_RDB07388#2_2_E10_05_ABI08.ab1
    1 CCGGACCAAA AGAAAAAGAA ATTAGTGAGG ACCCAAATAA ATTTTGTTTC TAGTGGATTG
   61 TATCAATTTT TATCATATAT AAATTAAAAG ATATTAAAAC AAAATATTAA AAATATTAAT
  121 TCATTTAAGA GAATATTAAT AACCCATTAC ATGTTAATAG AAACAACTTT TTTTTTTTTT
  181 TTGAGTCAGA GTCTTGCTCT GTCCCCAGGC TGGAGTGCAG TGGCATGATC TCGGCTCACT
  241 GCAACCTCCT TCTCCCGGGT TCAAGCGATT CTCCTGCCTC AGCCTCCCCA GTAACTGGAA
  301 CTACAGGCGT GTGCCACCAC ACCCAGCTAA TTTTTGTGTT TTTAGTAGAG ACGGGGTTTC
  361 ACCATGTTGG CCAGGATGGT CTTGATCTCT TGATCGGAAA TAACATATCT TTAATGAAAA
  421 AAAACTTAAT TTTTAATTTT TCCAAAATAA ACAACGTATA GGCCGGGAAC GGTGGCTCAC
  481 GCCTGTAATC GCAGCATTTT GGTAGGCCGA GGCAGGCAGA TCACGAGGTC AGGAGTTCAA
  541 GACTAACCTG GCCAACATGA TGAAACCCTG TCTCTACTAA CAATACAAAA ATTAGCCGGG
  601 TGTGGTGGTG CGCGCCTGTA ATTCCAGCAA CTCTGGAGGC TGAGAATCCT CGAGGCTAGC
  661 GAGCTCAGGT ACCGGCCAGT TAGGCCAGAG AAATGTTCTG GCACCTGCAC TTGCACTGGG
  721 GACAGCCTAT TTTGCTAGTT TGTTTTGTTT CGTTTTGTTT TGATGGAGAG CGTATGTTAG
  781 TACTATCGAT TCACACAAAA AACCAACACA CAGATGTAAT GAAAAATAAA GATATTTTTA
  841 ATGGCGGCCT GGTCCAATAC CTCCCGGTAC CTTTAATATT ACTTTACTTT ATCCTTGAAG
  901 AGAACGGTAC CTAGTTAACC CCTGGATTAA ATTGCCTTTC AATTAATAAT TTGAAAAAAG
  961 GACGAGGTAA TGAAGCATTC CCAACAATTT TTCGTGGTTC GCACTTCATT TCCCTTTCCT
 1021 TTTGGCAGGC AATTTTTAGC ATTGGCCTTG GTTTATATTG CACCAACTCC CGAAAACGCT
 1081 TGGGTGAAAA GTTCAGAAGA TGCTGAAGGA TTCAAACCTG GGTTGCAAGA AGGTTGGCTT
1141 ATTATCCGAA CTTGGAATTT CCCTCACAAA TAAAGCG
//
Primer: pGL4-136R RDB07388_A7Eob.seq
>RDB07388_07388_A7Eo_pGL4-136R_D02_11_ABI24.ab1
    1 GCACCTTGTT TTTGGCATCT TCATGGTGGC TTTACCAACA GTACCGGATT GCCAAGCTTG
   61 GCCGCCGAGG CCAGATCTTG ATCATGATCC CAGCCTCTGA GTCCTGAGAA CTTCTTGAGT
  121 CCGGATGGGG ACTTTATAGT CGGGAGTCGT GGCGACGCTG ATTGGCTTCT CTAGAAACCC
  181 GACACCCATT GGGAATGAGA ACTGAGTCTG CGTCATGAGT ATCCAGGAAG AAGGACACAT
  241 GACCAGGTTA CGAGAGGAAC GGGAAACTGC AGAGTTTCCC AGCAATCAGC AGTTCTTAAA
  301 CTTTTAGGTT TCGGTATCTC TGCACACTCT TAGAAATTAG TCCTGGCTGG GCGCGGTGGC
  361 TCACGCCTGT AATCTCAGCA CTTTGGGAGG CCAAGGCGGG CTGATCACCT GAGGTTGGGA
  421 GTTCGAGACC AGCCCGACCA ATATGGAGAA ACCCTGTCTC TACTAAAAGT CCAAAAAATT
  481 AGCCGGCGTG GTGGCGCATG GCTGTAATCC TGGTACTTGG GAGGCTGAGA CAGGAGAATC
  541 ACTTGAACCC AGGAGGAGGA GGTTGCGGTG AGCCAAGATC GTGCCATTGC CCTCCAGCCT
  601 GGGCAACAAG AAAAAAGAAA TTAGTGAGGA CCCAAATAAA TTTTGTTTCT GTGGATTGTA
  661 TCAATTTTTA TCATATATAA ATTAAAAGAT ATTAAAACAA AATATTAAAA ATATTAATTC
  721 ATTTAAGAGA ATATTAATAA CCCATTACAT GTTAATAGAA ACAACTTTTT TTTTTTTTTT
  781 GAGTCAGAGT CTTGCTCTGT CCCCAGGGCT GGAGTGCAGT GGCATGATCC TCGGCTCACT
841 GCAACCTTCC TTCTCCTGGG GTTCAGGCG
//
Primer: pAxALNL_F1 RDB07388_A7Eoc.seq
>RDB07388_07388_A7Eo_pAxCALNL_F1_E02_14_ABI24.ab1
    1 CTCAAGGTAT CTTATCATGT CTGCTCGAAG CGGCCGGCCG CCCCGACTCT AGAATTATTA
   61 CACGGCGATC TTGCCGCCCT TCTTGGCCTT AATGAGAATC TCGCGGATCT TGCGGGCGTC
  121 CAACTTGCCG GTCAGTCCTT TAGGCACCTC GTCCACGAAC ACAACACCAC CGCGCAGCTT
  181 CTTGGCGGTT GTAACCTGGC TGGCCACATA GTCCACGATC TCCTTCTCGG TCATGGTTTT
  241 ACCGTGTTCC AGCACGACGA CTGCGGCGGG CAGCTCGCCG GCATCGTCGT CGGGCAGGCC
  301 GGCGACCCCG GCGTCGAAGA TGTTGGGGTG TTGCAGCAGG ATGCTCTCCA GTTCGGCTGG
  361 GGCTACCTGG TAGCCCTTGT ATTTGATCAG GCTCTTCAGC CGGTCCACGA TGAAGAAGTG
  421 CTCGTCCTCG TCCCAGTAGG CGATGTCGCC GCTGTGCAGC CAGCCGTCCT TGTCGATGAG
  481 AGCGTTTGTA GCCTCGGGGT TGTTAACGTA GCCGCTCATG ATCATGGGGC CACGGACGCA
  541 CAGCTCGCCG CGCTGGTTCA CACCCAGTGT CTTACCGGTG TCCAAGTCCA CCACCTTAGC
  601 CTCGAAGAAG GGCACCACCT TGCCTACTGC GCCAGGCTTG TCGTCCCCTT CGGGGGTGAT
  661 CAGAATGGCG CTGGTTGTTT CTGTCAGGCC GTAGCCCTGG CGGATGCCTG GTAGGTGGAA
  721 GCGTTTGGCC ACGGCCTCAC CTACCTCCTT GCTGAGCGGC GCCCCGCCGC TGGCGATCTC
  781 GTGCAAGTTG CTTAGGTCGT ACTTGTCGAT GAGAGTGCTC TTAGCGAAGA AGCTAAATAG
  841 TGTGGGCACC AGCAGGGCAG ATTGAATCTT ATAGTCTTGC AAGCTGCGCA AGAATAGCTC
  901 CTCCTCGAAG CGGTACATGA GCACGACCCG AAAGCCGCAG ATCAAGTAGC CCAGCGTGGT
  961 GAACATGCCG AAGCCGTGGT GAAATGGCAC CACGCTGAGG ATAGCGGTGT CGGGGATGAT
 1021 CTGGTTTGCC GAAGATGGGG GTCGCGGGCA TGACTGAAAT CGGGACACAG CGATGCGATG
1081 CGGTAGGCTA CGCCCTGGCC ATCAGTACTG CCACTACTGT TCATGAATCA GGGGCGGT
//

Please visit Sequencing and PCR primers for primer information.


References

References


2018.12.10

GNP_filter3_RDBDEP_html_181012.pl