Prev. |  KEGG KO K06751 > 

RIKEN DNA Bank Human Resource - HLA-E

Gene ID NCBI Gene 3133 |  KEGG hsa:3133
Gene Symbol HLA-E
Protein Name major histocompatibility complex, class I, E
Synonyms HLA-6.2|QA1
Featured content Endocytosis (human)
Featured content HLA - human
Ortholog resource in our bank

  HLA-E

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB07388 pGL4-phHLA-E Promoter collection, Human HLA-E promoter

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY096623 IRAL041J07 pDNR-LIB BC040479 NM_005516 Full
HGY081676 IRAL004D04 pOTB7 BC002578 NM_005516 Full/var
HGY085250 IRAL013C02 pOTB7 BC004297 NM_005516 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR168481 ARi21D09 pGCAP10 NM_005516.4  
GCTCAGGACTCAGAGGCTGGGATCATGGTAGATGGAACCCTCCTTTTACTCCTCTCGGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.05.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl