Resource data sheet
Prev.

pGL4-phPCNA

Promoter collection, Human PCNA promoter

Catalog number RDB07365
Resource name pGL4-phPCNA
Alternative name U2686(2064)-4
Clone info. Promoter collection. PCR amplified human PCNA promoter sequence was inserted into a firefly luciferase vector.
F-primer: TGGCCTCCTTCCTACTCTCC; R-primer: AACCGGTTACCTCCAGAACC. Entire sequence of promoter region has not been confirmed.
Vector backbone pGL4.10 [Luc2] (Plasmid)
Selectable markers Amp^r
Gene/insert name Human proliferating cell nuclear antigen genomic DNA
Depositor DNA Bank, |
 
Other clones in our bank human PCNA (NCBI Gene 5111) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.
Additional terms and conditions for distribution The use of the BIOLOGICAL RESOURCE is restricted to the academic researches conducted by non-profit organization. By using this material, the RECIPIENT agrees to be bound by the conditions of the limited use statement of the Promega Corporation.
Ordering Please visit Information of Request for Distribution. 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA) [Word]
Distribution information (domestic users) [open/close]


Catalog # Resource name Shipping form Fee (non-profit org.)
RDB07365 pGL4-phPCNA DNA solution

Ordering Information [in Japanese] [in English]

References and tips

Electronic file

Electronic file PDF RDB07365.pdf from Depositor

Featured content

Featured content Promoter Collection (Firefly Luciferase) (English text)

References

User reports and related articles (go to bottom)


Sequence information

This clone will be sequenced a portion and digested by restriction enzyme for examination.


References

References

user report Huang, L., Interferon regulatory factor 7 protects against vascular smooth muscle cell proliferation and neointima formation. J. Am. Heart Assoc. 3 (5). pii: e001309 (2014). PMID 25304854.

2018.12.10

GNP_filter3_RDBDEP_html_181012.pl