Resource data sheet
Prev.
Please review the QC test results indicated by check icon below as well as clone information before placing your order.

pGL4-phIL8

Promoter collection, Human IL8 promoter

Catalog number RDB07322
Resource name pGL4-phIL8
Alternative name U2680(2058)-6
Clone info. PCR amplified human IL8 promoter sequence was inserted into a firefly luciferase vector. Cloned fragment: 73739341 to 73740603(NC_000004.12); relatively -1165 to +98, where +1 corresponds to 1 nt of NM_000584.3.
PCR cloning, forward primer: ACCCTTCCTTGGTGCTCTTT; reverse primer: GAAGCTTGTGTGCTCTGCTG. Entire sequence of promoter region has not been confirmed. Known difference (at least): A to T substitution at 73,740,307 of NC_000004.12.
Vector backbone pGL4.10 [Luc2] (Plasmid)
Selectable markers Amp^r
Gene/insert name Human interleukin 8 genomic DNA
Depositor|Developer DNA Bank, |
 
Other clones in our bank human IL8 (NCBI Gene 3576) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.
Additional terms and conditions for distribution The use of the BIOLOGICAL RESOURCE is restricted to the academic researches conducted by non-profit organization. By using this material, the RECIPIENT agrees to be bound by the conditions of the limited use statement of the Promega Corporation.
Ordering Please visit Information of Request for Distribution.[link] 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA) [Word]
Distribution information (domestic users) [open/close]


Catalog # Resource name Shipping form Fee (non-profit org.)
RDB07322 pGL4-phIL8 DNA solution

Ordering Information [in Japanese] [in English]
Please review the QC test results indicated by check icon below as well as clone information before placing your order.

References and tips

Electronic file

Electronic file Remarks, protocol and/or map (pdf) RDB07322.pdf

Original reference

Further references such as user reports and related articles (go to bottom)

Featured content

Featured content Promoter Collection (Firefly Luciferase) (English text)

Sequence information

RIKEN BRC has sequenced portions of this material for quality test.
Please review the QC test results indicated by check icon as well as clone information before placing your order.

Test sheet RDB07322_A3I5p1.pdf check

Nucleotide sequence of a portion of this resource (if available).

Primer: pGL4-4174F
Sequence file: RDB07322_A3I5a.seq check
>07322_07322_A3I5_pGL4-4174F_E04_13.ab1
    1 ACTAGGGCAG ACATTTCTCT GGCCTAACTG GCCGGTACCT GAGCTCGCTA GCCTCGAGGA
   61 TACCCTTCCT TGGTGCTCTT TATCTACAGA ATCCAAGACC TTTCAAGAAA GGTCTTGGAT
  121 TCTTTTCTTC AGGACACTAG GACATAAAGC CACCTTTTTA TGATTTGTTG AAATTTCTCA
  181 CTCCATCCCT TTTGCTAGTG ATCATGGGTC CTCAGAGGTC AGACTTGGTG TCCTTGGATA
  241 AAGAGCATGA AGCAACAGTG GCTGAACCAG AGTTGGAACC CAGATGCTCT TTCCACTAAG
  301 CATACAACTT TCCATTAGAT AACACCTCCC TCCCACCCCA ACCAAGCAGC TCCAGTGCAC
  361 CACTTTCTGG AGCATAAACA TACCTTAACT TTACAACTTG AGTGGCCTTG AATACTGTTC
  421 CTATCTGGAA TGTGCTGTTC TCTTTCATCT TCCTCTATTG AAGCCCTCCT ATTCCTCAAT
  481 GCCTTGCTCC AACTGCCTTT GGAAGATTCT GCTCTTATGC CTCCACTGGA ATTAATGTCT
  541 TAGTACCACT TGTCTATTCT GCTATATAGT CAGTCCTTAC ATTGCTTTCT TCTTCTGATA
  601 GACCAAACTC TTTAAGGACA AGTACCTAGT CTTATCTATT TCTAGATCCC CCACATTACT
  661 CAGAAAGTTA CTCCATAAAT GTTTGTGGAA CTGATTTCTA TGTGAAGCAC ATGTGCCCCT
  721 TCACTCTGTT AACATGCATT AGAAAACTAA ATCTTTTGAA AAGTTGTAGT ATGCCCCCTA
  781 AGAGCAGTAA CAGTTCCTAG AAACTCTCTA AAATGCTTAG AAAAAGATTT ATTTTAAATT
  841 ACCTCCCCAA TAAAATGATT GGCTGGCTTA TCTTCACCAT CATGATAGCA TCTGTAATTA
  901 ACTGAAAAAA AAATAATTAT GCCATTAAAA GAAAATCATC CATGATCTTG TTCTAACACC
  961 TGCCACTCTA GTACTATATC TGTCACATGG TACTATGATA AGTTATCTAG AAATAAAAAA
 1021 AGCATACATT TGATAATTCC ACCAAATGTG CAGCTTCAGT ATTTTTAAAT GTATATTAAA
 1081 ATTAATTATT TTTAAAGATC CAAGGAACTT CGTTCATACC TCCGTATTTG ATACGACCAA
1141 TAGCCAGTTG ATGCACTCAG CATATGACCC CCCTA
//
Primer: pGL4-136R
Sequence file: RDB07322_A3I5b.seq check
>07322_07322_A3I5_pGL4-136R_F04_16.ab1
    1 GCATTATTGT TTTGGCATCT TCCATGGTGG CTTTACCAAC AGTACCGGAT TGCCAAGCTT
   61 GGCCGCCGAG GCCAGATCTT GATGAAGCTT GTGTGCTCTG CTGTCTCTGA AAGTTTGTGC
  121 CTTATGGAGT GCTCCGGTGG CTTTTTATAT CATCACCCTA CTAGAGAACT TATGCACCCT
  181 CATCTTTTCA TTATGTCAGA GGAAATTCCA CGATTTGCAA CTGATGGCCC ATCCCCTCAG
  241 GGCAAACCTG AGTCATCACA CTTCCTATTT GTTCCTTATC AAATACGGAG TATGACGAAA
  301 GTTTTCTTTG ATCTTTAAAA TAATTTAATT TTAATATACA TTTAAAATAC TGAAGCTCCA
  361 CAATTTGGTG AATTATCAAA TGTATGCTTT TTTATTTCTA GATAACTTTA TCATAGTACC
  421 ATGTGACAGA TATAGTACTA GAGTGGCAGG TGTTAGAACA AGATCATGGA TGATTTTCTT
  481 TTAATGGCAT AATTATTTTT TTTCAGTTAA TTACAGATGC TATCATGATG GTGAAGATAA
  541 GCCAGCCAAT CATTTTATTG GGGAGGTAAT TTAAAATAAA TCTTTTTCTA AGCATTTTAG
  601 AGAGTTTCTA GGAACTGTTA CTGCTCTTAG GGGGCATACT ACAACTTTTC AAAAGATTTA
  661 GTTTTCTAAT GCATGTTAAC AGAGTGAAGG GGCACATGTG CTTCACATAG AAATCAGTTC
  721 CACAAACATT TATGGAGTAA CTTTCTGAGT AATGTGGGGG ATCTAGAAAT AGATAAGACT
  781 AGGTACTTGT CCTTAAAGAG TTTGGTCTAT CAGAAGAAGA AAGCAATGTA AGGACTGACT
  841 ATATAGCAGA ATAGACAAGT GGTACTAAGA CATTAATTCC AGTGGAGGCA TAAGAGCAGA
  901 ATCTTCCAAA GGCAGTTGGA GCAAGGCATT GAGGAATAGG AGGGCTTCAA TAGAGGAAGA
  961 TGAAAGAGAA CAGCACATTC CAGATAGGAA CAGTATTCAA GGCCACTCAA GTTTGTAAAG
 1021 TTAAGTATGT TTATGCTCCA GAAAGTGGTG CACTGCAGCT GCTTGGTTGG GGGTGGGAGG
 1081 GAGTGTATCT AATGCAAAGT TGTTATGCCT AGTGGCAAAG AGCCATCTGG GATCCACTCT
1141 GATCAGCCCA CTGTTGCTCA TGCTCTTTAA TACCAAAAGA
//
Primer: pAxCALNL_F1
Sequence file: RDB07322_A3I5c.seq check
>07322_07322_A3I5_pAxCALNL_F1_G11_20_ABI24.ab1
    1 ATAAGGCTAT CTTATCATGT CTGCTCGAAG CGGCCGGCCG CCCCGACTCT AGAATTATTA
   61 CACGGCGATC TTGCCGCCCT TCTTGGCCTT AATGAGAATC TCGCGGATCT TGCGGGCGTC
  121 CAACTTGCCG GTCAGTCCTT TAGGCACCTC GTCCACGAAC ACAACACCAC CGCGCAGCTT
  181 CTTGGCGGTT GTAACCTGGC TGGCCACATA GTCCACGATC TCCTTCTCGG TCATGGTTTT
  241 ACCGTGTTCC AGCACGACGA CTGCGGCGGG CAGCTCGCCG GCATCGTCGT CGGGCAGGCC
  301 GGCGACCCCG GCGTCGAAGA TGTTGGGGTG TTGCAGCAGG ATGCTCTCCA GTTCGGCTGG
  361 GGCTACCTGG TAGCCCTTGT ATTTGATCAG GCTCTTCAGC CGGTCCACGA TGAAGAAGTG
  421 CTCGTCCTCG TCCCAGTAGG CGATGTCGCC GCTGTGCAGC CAGCCGTCCT TGTCGATGAG
  481 AGCGTTTGTA GCCTCGGGGT TGTTAACGTA GCCGCTCATG ATCATGGGGC CACGGACGCA
  541 CAGCTCGCCG CGCTGGTTCA CACCCAGTGT CTTACCGGTG TCCAAGTCCA CCACCTTAGC
  601 CTCGAAGAAG GGCACCACCT TGCCTACTGC GCCAGGCTTG TCGTCCCCTT CGGGGGTGAT
  661 CAGAATGGCG CTGGTTGTTT CTGTCAGGCC GTAGCCCTGG CGGATGCCTG GTAGGTGGAA
  721 GCGTTTGGCC ACGGCCTCAC CTACCTCATT GCTGAGCGGC GCCCCGCCGC TGGCGATCTC
  781 GTGCAAGTTG CTTAGGTCGT ACTTGTCGAT GAGAGTGCTC TTAGCGAAGA AGCTAAATAG
  841 TGTGGGCACC AGCAGGGCAG ATTGAATCTT ATAGTCTTGC AAGCTGCGCA AGAATAGCTC
  901 CTCCTCGAAG CGGTACATGA GCACGACCCG AAAGCCGCAG ATCAAGTAGC CCAGCGTGGT
  961 GAACATGCCG AAAGCCGTGG TGAAATGGCA CCACGCTGAG GATAGCGGTG TCGGGGATGA
 1021 TCTGGGTTGC CGAAGATGGG GTCGCGGGCA TGACTGATCG GACACAAGCG GGTGCGTTGC
 1081 GGTAGGCTAC GCCCATTGGG GCCAATTCGT ACTGGCACTT ACTGTTCAAT GATCAAGGGC
1141 GAATGGTTTT TTGTGTTCCC CGGGGTC
//

Please visit Sequencing and PCR primers for primer information.


References

Original, user report and related articles

user report Suzuki, T., Arsenite-induced histone H3 modification and its effects on EGR1 and FOS expression in HeLa cells. J. Appl. Toxicol. 38 (5): 734-743 (2018) PMID 29350772.

2020.10.02

GNP_filter3_RDBDEP_html_200316.pl