Resource data sheet
Prev.

pGEM3Zf_hsNCAMtv1

Plasmid vector of human NCAM cDNA transcription variant 1

Catalog number RDB07010
Resource name pGEM3Zf_hsNCAMtv1
Alternative name SET-0255_1
Clone info. Plasmid vector of human NCAM cDNA transcription variant 1.
F-primer: atgctgcaaactaaggatctcatct; R-primer: tgctcggttctcttcacccatcat. Nucleotide substitution T1960G (V540V) to NM_000615.
Vector backbone pGEM-3Zf(+) (Plasmid)
Selectable markers Amp^r
Gene/insert name Human neural cell adhesion molecule 1, transcript variant 1 cDNA
Depositor Nakamura, Yukio |
 
Other clones in our bank human NCAM, CD56, MSK39 (NCBI Gene 4684) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR 1. The RECIPIENT agrees to use the BIOLOGICAL RESOURCE only for academic research in the non-profit organization. 2. In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.
Ordering Please visit Information of Request for Distribution. 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA) [Word]
Distribution information (domestic users) [open/close]


Catalog # Resource name Shipping form Fee (non-profit org.)
RDB07010 pGEM3Zf_hsNCAMtv1 DNA solution

Ordering Information [in Japanese] [in English]

References and tips

Electronic file

Featured content

References

User reports and related articles (go to bottom)


Sequence information

This clone will be sequenced a portion and digested by restriction enzyme for examination.


References

References


2018.11.21

GNP_filter3_RDBDEP_html_181012.pl