DNA Bank Top |  KEGG KO K06491 > 

RIKEN DNA Bank Human Resource - NCAM1

Gene ID NCBI Gene 4684 |  KEGG hsa:4684
Gene Symbol NCAM1
Protein Name neural cell adhesion molecule 1
Synonyms CD56|MSK39|NCAM

Link

Ortholog resource in our bank

  NCAM1


External database

human NCAM1

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB07027 pCMFlag_hsNCAM tv1 Expression vector of human NCAMtv1.    
RDB07010 pGEM3Zf_hsNCAMtv1 Plasmid vector of human NCAM cDNA transcription variant 1.    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX032976 IRAK082H08 pCMV-SPORT6 BC047244 NM_181351 Full
HGY092285 IRAL030L21 pOTB7 BC014205 NM_181351 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE030463 W01A076C15 pENTR-TOPO IRAK082H08 BC047244 NM_181351  
HGE030469 W01A076C21 pENTR-TOPO IRAK082H08 BC047244 NM_181351  
HGE030471 W01A076C23 pENTR-TOPO IRAK082H08 BC047244 NM_181351  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR409096 RBdS022M08 pGCAP10 NM_000615.5  
GGAGTTGCGAGTGTGCTGAGGCTGGGACTGTCACTCATTCTCCGATCAGCGCGTGAACGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


2025.03.19

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl