Resource data sheet
Prev.

pCMFlag_hsIL2RG

Expression vector of human IL2RG

Catalog number RDB07006
Resource name pCMFlag_hsIL2RG
Alternative name SET-0197_4
Clone info. Expression vector of human IL2RG. Expression has not yet been confirmed.
Derived from Sugano TMS05755. F-primer: atgttgaagccatcattaccattc; R-primer: ttcaggtttcaggctttaggg.
Vector backbone pCMV_S-FLAG (Plasmid)
Size of vector backbone 5.5 kb
Selectable markers Amp^r (E. coli), Neo^r (mammalian cell)
Gene/insert name Human IL2RG/IL-2R gamma cDNA
Depositor DNA Bank, |
 
Other clones in our bank human IL2RG (NCBI Gene 3561) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR The RECIPIENT agrees to describe RIKEN BRC as the source of the MATERIAL and cite Gene 200, 149-156, 1997 in any publication.
Ordering Please visit Information of Request for Distribution. 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA) [Word]
Distribution information (domestic users) [open/close]


Catalog # Resource name Shipping form Fee (non-profit org.)
RDB07006 pCMFlag_hsIL2RG DNA solution

Ordering Information [in Japanese] [in English]

References and tips

Electronic file

Featured content

References

User reports and related articles (go to bottom)


Sequence information

RIKEN BRC has sequenced portions of this material for quality test. Primers and the results are shown below.

Data are summerized on test sheet below.

Test sheet RDB13004_A4Jv.pdf

Nucleotide sequence of a portion of this resource (if available).

Primer: CMV-Forward RDB13004_A4Jva.seq
>07006_13004_A4Jv_CMV-Forward_E07_13.ab1
    1 CTTCCACTCC GCCCATTGAC GCAATGGGCG GTAGGCGTGT ACGGTGGGAG GTCTATATAA
   61 GCAGAGCTCT CTGGCTAACT AGAGAACCCA CTGCTTACTG GCTTATCGAA ATTAATACGA
  121 CTCACTATAG GGAGACCCAA GCTGAATTCA CCATGGACTA CAAGGACGAT GACGATAAGG
  181 CGGCCATGTT GAAGCCATCA TTACCATTCA CATCCCTCTT ATTCCTGCAG CTGCCCCTGC
  241 TGGGAGTGGG GCTGAACACG ACAATTCTGA CGCCCAATGG GAATGAAGAC ACCACAGCTG
  301 ATTTCTTCCT GACCACTATG CCCACTGACT CCCTCAGTGT TTCCACTCTG CCCCTCCCAG
  361 AGGTTCAGTG TTTTGTGTTC AATGTCGAGT ACATGAATTG CACTTGGAAC AGCAGCTCTG
  421 AGCCCCAGCC TACCAACCTC ACTCTGCATT ATTGGTACAA GAACTCGGAT AATGATAAAG
  481 TCCAGAAGTG CAGCCACTAT CTATTCTCTG AAGAAATCAC TTCTGGCTGT CAGTTGCAAA
  541 AAAAGGAGAT CCACCTCTAC CAAACATTTG TTGTTCAGCT CCAGGACCCA CGGGAACCCA
  601 GGAGACAGGC CACACAGATG CTAAAACTGC AGAATCTGGT GATCCCCTGG GCTCCAGAGA
  661 ACCTAACACT TCACAAACTG AGTGAATCCC AGCTAGAACT GAACTGGAAC AACAGATTCT
  721 TGAACCACTG TTTGGAGCAC TTGGTGCAGT ACCGGACTGA CTGGGACCAC AGCTGGACTG
  781 AACAATCAGT GGATTATAGA CATAAGTTCT CCTTGCCTAG TGTGGATGGG CAGAAACGCT
  841 ACACGTTTCG TGTTCGGAGC CGCTTTAACC CACTCTGTGG AAGTGCTCAG CATTGGAGTG
  901 AATGGAGCCA CCCAATCCAC TGGGGGGAGC AATACTTCAA AAGAGAATCC TTTCCTGTTT
  961 GCATTGGAAA GCCGTGGTTA TCTCTGTTGG CTCCATGGGA TTGATTATCA GCCTTTCTCT
 1021 GTGTGTATTT CTGGCTGGGA ACGGAACGAT GCCCCGAATT TCCCCACCCT GAAGATTAGA
 1081 GGAATCTTGT TACTGATACC ACGGACCTTT TCCACTGCAG TTGATGGTGT CTAACGGACG
1141 TTGGGCTTGG AGAAGTCCCT GC
//
Primer: BGH_rev RDB13004_A4Jvb.seq
>07006_13004_A4Jv_BGH_rev_F07_16.ab1
    1 GCTGGCATTA GGTGCCTATA GAATAGGGCC CTCTAGATGC ATGCTCGAGC GGCCTTCAGG
   61 TTTCAGGCTT TAGGGTGTAA CATGGGGGGG CCCAGTAGGG GCTATGCTGG TTGCATGGGG
  121 AGGCCCCAGG CCCCTCCCCA AGGGCCCCTC CTTTTGGGGG AATCTCACTG ACGAGGCAGA
  181 GTCGTTCACT GTAGTCTGGC TGCAGACTCT CAGCCAGTCC CTTAGACACA CCACTCCAGG
  241 CCGAAAAGTT CCCGTGGTAT TCAGTAACAA GATCCTCTAG GTTCTTCAGG GTGGGAATTC
  301 GGGGCATCGT CCGTTCCAGC CAGAAATACA CACAGAGAAG GCTGATAATC AATCCCATGG
  361 AGCCAACAGA GATAACCACG GCTTCCAATG CAAACAGGAA AGGATTCTCT TTTGAAGTAT
  421 TGCTCCCCCA GTGGATTGGG TGGCTCCATT CACTCCAATG CTGAGCACTT CCACAGAGTG
  481 GGTTAAAGCG GCTCCGAACA CGAAACGTGT AGCGTTTCTG CCCATCCACA CTAGGCAAGG
  541 AGAACTTATG TCTATAATCC ACTGATTGTT CAGTCCAGCT GTGGTCCCAG TCAGTCCGGT
  601 ACTGCACCAA GTGCTCCAAA CAGTGGTTCA AGAATCTGTT GTTCCAGTTC AGTTCTAGCT
  661 GGGATTCACT CAGTTTGTGA AGTGTTAGGT TCTCTGGAGC CCAGGGGATC ACCAGATTCT
  721 GCAGTTTTAG CATCTGTGTG GCCTGTCTCC TGGGTTCCCG TGGGTCCTGG AGCTGAACAA
  781 CAAATGTTTG GTAGAGGTGG ATCTCCTTTT TTTGCAACTG ACAGCCAGAA GTGATTTCTT
  841 CAGAGAATAG ATAGTGGCTG CACTTCTGGA CTTTATCATT ATCCGAGTTC TTGTACCAAT
  901 AATGCAGAGT GAGGTTGGTA GGCTGGGGCT CAGAGCTGCT GTTCCAAGTG CAATTCATGT
  961 ACTCGACATT GAACACAAAA CACTGAACCC TCTGGGAGGG GCAGAGTGGA AAACACTGAG
 1021 GGAGTCAGTG GGGCATAGTG GTCAGAGAAT CAGCTGTGGT GTCTCATCCC ATTGGGCGTC
 1081 AGAATTGTCG TGATCAGCCC AACTCCCAGG CAGGGCCAGC CTGCAAGCAT TAAGAGGGCA
1141 TGGTGTGCAT
//

Please visit Sequencing and PCR primers for primer information.


References

References


2018.10.22

GNP_filter3_RDBDEP_html_181012.pl