Resource data sheet
Prev.

pCMFlag_hsIL6

Expression vector of human IL6

Catalog number RDB06998
Resource name pCMFlag_hsIL6
Alternative name SET-0199_12-1
Clone info. Expression vector of human IL6.
Derived from Sugano CAS04362. F-primer: atgaactccttctccacaagc; R-primer: ctacatttgccgaagagccctc.
Vector backbone pCMV_S-FLAG (Plasmid)
Size of vector backbone 5.5 kb
Selectable markers Amp^r (E. coli), Neo^r (mammalian cell)
Gene/insert name Human IL6 cDNA
Depositor DNA Bank, |
 
Other clones in our bank human IL6 (NCBI Gene 3569) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Ordering Information [in Japanese] [in English]
Terms and conditions set forth by the DEPOSITOR The RECIPIENT agrees to describe RIKEN BRC as the source of the MATERIAL and cite Gene 200, 149-156, 1997 in any publication.
(Japanese text [open/close])

Catalog # Resource name Shipping form Fee (non-profit org.)
RDB06998 pCMFlag_hsIL6 DNA solution

Sequence information

RIKEN BRC has sequenced portions of this material for quality test. Primers and the results are shown below.

Data are summerized on test sheet below.

Test sheet RDB12822_A4Ggp1.pdf

Nucleotide sequence of a portion of this resource (if available).

Primer: CMV-Forward RDB12822_A4Gga_2.seq
>06998_12822_A4Gg_CMV-Foward_A08_02.ab1
    1 CTTAACAACC TTTCCGCCCC CATTTGACCG CAAATGGGCG GTAGGCGGTG TACGGTGGGA
   61 GGTCTTATAT AAGCAGAGCT CTCTGGCTAA CTAGAGAACC CACTGCTTAC TGGCTTATCG
  121 AAATTAATAC GACTCACTAT AGGGAGACCC AAGCTGAATT CACCATGGAC TACAAGGACG
  181 ATGACGATAA GGCGGCCATG AACTCCTTCT CCACAAGCGC CTTCGGTCCA GTTGCCTTCT
  241 CCCTGGGGCT GCTCCTGGTG TTGCCTGCTG CCTTCCCTGC CCCAGTACCC CCAGGAGAAG
  301 ATTCCAAAGA TGTAGCCGCC CCACACAGAC AGCCACTCAC CTCTTCAGAA CGAATTGACA
  361 AACAAATTCG GTACATCCTC GACGGCATCT CAGCCCTGAG AAAGGAGACA TGTAACAAGA
  421 GTAACATGTG TGAAAGCAGC AAAGAGGCAC TGGCAGAAAA CAACCTGAAC CTTCCAAAGA
  481 TGGCTGAAAA AGATGGATGC TTCCAATCTG GATTCAATGA GGAGACTTGC CTGGTGAAAA
  541 TCATCACTGG TCTTTTGGAG TTTGAGGTAT ACCTAGAGTA CCTCCAGAAC AGATTTGAGA
  601 GTAGTGAGGA ACAAGCCAGA GCTGTGCAGA TGAGTACAAA AGTCCTGATC CAGTTCCTGC
  661 AGAAAAAGGC AAAGAATCTA GATGCAATAA CCACCCCTGA CCCAACCACA AAATGCCAGC
  721 CTGCTGACGA AGCTGCAGGC ACAGAACCAG TGGCTGCAGG ACATGACAAC TCATCTCATT
  781 CTGCGCAGCT TTAAAGGAGT TCCTGCAGTC CAGCCTGAGG GCTCTTCGGC AAAATGTAGG
  841 GCCCGCTCGA GCATGCATCT AGAGGGCCCT ATTCTATAGT GTCACCCTAA AATGCTAAAG
  901 CTCGCTGATC AGCCCTCGAA CTGTGCCTTC TAATTTGCCC AGCCCATCTG TTGTTTGCCC
  961 CTCCCCCCGT GCCTTCCTTG ACCCTGGAAG GTGCCAACTC CCCACTTGTC CTTTTCCTAA
 1021 TAAAATGAAG GAAAATTGCA TCCGCATTTG TCCTGAGTAG GTGTCCATTT CTATTCTGGG
 1081 GGGTTGGGGC TGGGGGGCAA GGACACAAGC CAATGGGGGG AAAGATCTGG GGAAAAAAAC
 1141 AAAATAACCA AGGCATTGCT TGGGTAATGC CGGGTGGGCC TTCTAATTGC CCTTCCTGTG
1201 AGAGGCCGTA AAGAACCAGA CTTGGCGACT CTTGCGATAG AAGGTGGTGG TAGC
//
Primer: SV40pro_F_V2 RDB12822_A4Ggb_2.seq
>06998_12822_A4Gg_SV40pro_F_V2_E01_13.ab1
    1 TAGACTTTTG GAGCTAGGCT TTTGCAAAAG CTCCCGGGAG CTTGGATATC CATTTTCGGA
   61 TCTGATCAAG AGACAGGATG AGGATCGTTT CGCATGATTG AACAAGATGG ATTGCACGCA
  121 GGTTCTCCGG CCGCTTGGGT GGAGAGGCTA TTCGGCTATG ACTGGGCACA ACAGACAATC
  181 GGCTGCTCTG ATGCCGCCGT GTTCCGGCTG TCAGCGCAGG GGCGCCCGGT TCTTTTTGTC
  241 AAGACCGACC TGTCCGGTGC CCTGAATGAA CTGCAGGACG AGGCAGCGCG GCTATCGTGG
  301 CTGGCCACGA CGGGCGTTCC TTGCGCAGCT GTGCTCGACG TTGTCACTGA AGCGGGAAGG
  361 GACTGGCTGC TATTGGGCGA AGTGCCGGGG CAGGATCTCC TGTCATCTCA CCTTGCTCCT
  421 GCCGAGAAAG TATCCATCAT GGCTGATGCA ATGCGGCGGC TGCATACGCT TGATCCGGCT
  481 ACCTGCCCAT TCGACCACCA AGCGAAACAT CGCATCGAGC GAGCACGTAC TCGGATGGAA
  541 GCCGGTCTTG TCGATCAGGA TGATCTGGAC GAAGAGCATC AGGGGCTCGC GCCAGCCGAA
  601 CTGTTCGCCA GGCTCAAGGC GCGCATGCCC GACGGCGAGG ATCTCGTCGT GACCCATGGC
  661 GATGCCTGCT TGCCGAATAT CATGGTGGAA AATGGCCGCT TTTCTGGATT CATCGACTGT
  721 GGCCGGCTGG GTGTGGCGGA CCGCTATCAG GACATAGCGT TGGCTACCCG TGATATTGCT
  781 GAAGAGCTTG GCGGCGAATG GGCTGACCGC TTCCTCGTGC TTTACGGTAT CGCCGCTCCC
  841 GATTCGCAGC GCATCGCCTT CTATCGCCTT CTTGACGAGT TCTTCTGAGC GGGACTCTGG
  901 GGGTTCGAAA TGACCGACCA AGCGACGCCC AACCTGCCAT CACGAGATTT CGATTCCACC
  961 GCCCGCCCTT CTATGAAAGG TTGGGCTTCG GAATCGTTTT TCCCGGGACG CCCGGCTGGG
 1021 ATGATTCCTT CCCAGCGCGG GGGATCTCAT GCTGGGAGTT TCATCACCAC CCCGACCTTG
1081 CTTTATTGCA GGCATAATAA ATG
//

Please visit plasmidSequencing and PCR primers for primer information.

References and tips

Electronic file

Electronic file PDF RDB06998.pdf from Depositor

Featured content

Featured content pCMV_tag and pRSV_tag assay-ready clones (English text)

References

user report Yokoyama, C., Interleukin-8 enhances the effect of colchicine on cell death. Biochem Biophys Res Commun. 2017 Feb 9. pii: S0006-291X(17)30286-3 [Epub ahead of print] (2017). PMID 28189686.

2017.10.23

GNP_filter3_RDBDEP_171017_html.pl