Resource data sheet
Prev.

pCMFlag_hsTP53

Expression vector of human p53

Catalog number RDB06754
Resource name pCMFlag_hsTP53
Alternative name SET-0136_2-5
Clone info. Expression vector of human p53. Expression was confirmed by Western blotting with anti-FLAG antibody.
F-primer: gaggagccgcagtcagatcc; R-primer: tcagtctgagtcaggcccttc.
Vector backbone pCMV_S-FLAG (Plasmid)
Size of vector backbone 5.5 kb
Selectable markers Amp^r (E. coli), Neo^r (mammalian cell)
Gene/insert name Human tumor protein p53 cDNA
Depositor DNA Bank, |
 
Other clones in our bank human TP53 (NCBI Gene 7157) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR The RECIPIENT agrees to describe RIKEN BRC as the source of the MATERIAL in any publication.
Ordering Please visit Information of Request for Distribution. 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA) [Word]
Distribution information (domestic users) [open/close]


Catalog # Resource name Shipping form Fee (non-profit org.)
RDB06754 pCMFlag_hsTP53 DNA solution

Ordering Information [in Japanese] [in English]

References and tips

Electronic file

Electronic file PDF RDB06754.pdf from Depositor

Featured content

References

User reports and related articles (go to bottom)


Sequence information

RIKEN BRC has sequenced portions of this material for quality test. Primers and the results are shown below.

Data are summerized on test sheet below.

Test sheet RDB13744_A5Lop1.pdf

Nucleotide sequence of a portion of this resource (if available).

Primer: CMV-Forward RDB13744_A5Loa.seq
>06754_13744_A5Lo_CMV-Forward_A03_03.ab1
    1 TAATCAACTC CGCCCCATTG ACGCAATGGG CGGTAGGCGT GTACGGTGGG AGGTCTATAT
   61 AAGCAGAGCT CTCTGGCTAA CTAGAGAACC CACTGCTTAC TGGCTTATCG AAATTAATAC
  121 GACTCACTAT AGGGAGACCC AAGCTGAATT CACCATGGAC TACAAGGACG ATGACGATAA
  181 GGCGGCCGAG GAGCCGCAGT CAGATCCTAG CGTCGAGCCC CCTCTGAGTC AGGAAACATT
  241 TTCAGACCTA TGGAAACTAC TTCCTGAAAA CAACGTTCTG TCCCCCTTGC CGTCCCAAGC
  301 AATGGATGAT TTGATGCTGT CCCCGGACGA TATTGAACAA TGGTTCACTG AAGACCCAGG
  361 TCCAGATGAA GCTCCCAGAA TGCCAGAGGC TGCTCCCCCC GTGGCCCCTG CACCAGCAGC
  421 TCCTACACCG GCGGCCCCTG CACCAGCCCC CTCCTGGCCC CTGTCATCTT CTGTCCCTTC
  481 CCAGAAAACC TACCAGGGCA GCTACGGTTT CCGTCTGGGC TTCTTGCATT CTGGGACAGC
  541 CAAGTCTGTG ACTTGCACGT ACTCCCCTGC CCTCAACAAG ATGTTTTGCC AACTGGCCAA
  601 GACCTGCCCT GTGCAGCTGT GGGTTGATTC CACACCCCCG CCCGGCACCC GCGTCCGCGC
  661 CATGGCCATC TACAAGCAGT CACAGCACAT GACGGAGGTT GTGAGGCGCT GCCCCCACCA
  721 TGAGCGCTGC TCAGATAGCG ATGGTCTGGC CCCTCCTCAG CATCTTATCC GAGTGGAAGG
  781 AAATTTGCGT GTGGAGTATT TGGATGACAG AAACACTTTT CGACATAGTG TGGTGGTGCC
  841 CTATGAGCCG CCTGAGGTTG GCTCTGACTG TACCACCATC CACTACAACT ACATGTGTAA
  901 CAGTTCCTGC ATGGGCGGCA TGAACCGGGA GGCCCATCCT CACCATCATC ACACTGGAAG
  961 ACTCCAGTGG TAATCTACTG GGACGGAACA GCTTTGAGTG CGTGTTTGTG CCTTGTCCTG
 1021 GAGAGACCGG GCGGCACAGA AGGAAGGAGA ATCTTCCGGC AAGAAAAGGG GAGCCTTCAC
 1081 CACGGGAGCC TGCCTCCAAG GGAAGCACTT AAGACGGAGC CACTGCCCAC AACTCCAGCT
1141 TCCTCTCTCC CCAGCCAAGG AGGAAACACA CTTGGCATAT GAAGAAATAT AAT
//
Primer: BGH_rev RDB13744_A5Lob.seq
>06754_13744_A5Lo_BGHrev_B03_06.ab1
    1 GTCCTGCATT GGTGAACTAT AGAATAGGGC CCTCTAGATG CATGCTCGAG CGGCCTCAGT
   61 CTGAGTCAGG CCCTTCTGTC TTGAACATGA GTTTTTTATG GCGGGAGGTA GACTGACCCT
  121 TTTTGGACTT CAGGTGGCTG GAGTGAGCCC TGCTCCCCCC TGGCTCCTTC CCAGCCTGGG
  181 CATCCTTGAG TTCCAAGGCC TCATTCAGCT CTCGGAACAT CTCGAAGCGC TCACGCCCAC
  241 GGATCTGAAG GGTGAAATAT TCTCCATCCA GTGGTTTCTT CTTTGGCTGG GGAGAGGAGC
  301 TGGTGTTGTT GGGCAGTGCT CGCTTAGTGC TCCCTGGGGG CAGCTCGTGG TGAGGCTCCC
  361 CTTTCTTGCG GAGATTCTCT TCCTCTGTGC GCCGGTCTCT CCCAGGACAG GCACAAACAC
  421 GCACCTCAAA GCTGTTCCGT CCCAGTAGAT TACCACTGGA GTCTTCCAGT GTGATGATGG
  481 TGAGGATGGG CCTCCGGTTC ATGCCGCCCA TGCAGGAACT GTTACACATG TAGTTGTAGT
  541 GGATGGTGGT ACAGTCAGAG CCAACCTCAG GCGGCTCATA GGGCACCACC ACACTATGTC
  601 GAAAAGTGTT TCTGTCATCC AAATACTCCA CACGCAAATT TCCTTCCACT CGGATAAGAT
  661 GCTGAGGAGG GGCCAGACCA TCGCTATCTG AGCAGCGCTC ATGGTGGGGG CAGCGCCTCA
  721 CAACCTCCGT CATGTGCTGT GACTGCTTGT AGATGGCCAT GGCGCGGACG CGGGTGCCGG
  781 GCGGGGGTGT GGAATCAACC CACAGCTGCA CAGGGCAGGT CTTGGCCAGT TGGCAAAACA
  841 TCTTGTTGAG GGCAGGGGAG TACGTGCAAG TCACAGACTT GGCTGTCCCA GAATGCAAGA
  901 AGCCCAGACG GAAACCGTAG CTGCCCTGGT AGGTTTTCTG GGAAAGGGAC AGAAGATGAC
  961 AGGGGCCAGG AGGGGGCTGG GTGCAGGGCC CGCCGGGTGT AGAGCTGCTG GGTGCAGGGC
 1021 CACGGGGGGG AGCAGCCTCT GGCATTCTGG GAGCTTCATC TGGGACCTGG GGTCTCAGTG
 1081 ACCATGATCA ATATCGTCCG GGACGCATCC AATTCATTCA TGCTGGGACG GCAAGGGGGA
1141 ACAGAAACGG
//
Primer: SV40pro_F_V2 RDB13744_A5Loc.seq
>06754_13744_A5Lo_SV40pro_F_V2_E12_15.ab1
    1 GAACTTTTTT GGAGCTAGGC TTTTGCAAAA GCTCCCGGGA GCTTGGATAT CCATTTTCGG
   61 ATCTGATCAA GAGACAGGAT GAGGATCGTT TCGCATGATT GAACAAGATG GATTGCACGC
  121 AGGTTCTCCG GCCGCTTGGG TGGAGAGGCT ATTCGGCTAT GACTGGGCAC AACAGACAAT
  181 CGGCTGCTCT GATGCCGCCG TGTTCCGGCT GTCAGCGCAG GGGCGCCCGG TTCTTTTTGT
  241 CAAGACCGAC CTGTCCGGTG CCCTGAATGA ACTGCAGGAC GAGGCAGCGC GGCTATCGTG
  301 GCTGGCCACG ACGGGCGTTC CTTGCGCAGC TGTGCTCGAC GTTGTCACTG AAGCGGGAAG
  361 GGACTGGCTG CTATTGGGCG AAGTGCCGGG GCAGGATCTC CTGTCATCTC ACCTTGCTCC
  421 TGCCGAGAAA GTATCCATCA TGGCTGATGC AATGCGGCGG CTGCATACGC TTGATCCGGC
  481 TACCTGCCCA TTCGACCACC AAGCGAAACA TCGCATCGAG CGAGCACGTA CTCGGATGGA
  541 AGCCGGTCTT GTCGATCAGG ATGATCTGGA CGAAGAGCAT CAGGGGCTCG CGCCAGCCGA
  601 ACTGTTCGCC AGGCTCAAGG CGCGCATGCC CGACGGCGAG GATCTCGTCG TGACCCATGG
  661 CGATGCCTGC TTGCCGAATA TCATGGTGGA AAATGGCCGC TTTTCTGGAT TCATCGACTG
  721 TGGCCGGCTG GGTGTGGCGG ACCGCTATCA GGACATAGCG TTGGCTACCC GTGATATTGC
  781 TGAAGAGCTT GGCGGCGAAT GGGCTGACCG CTTTCCTCGT GCTTTACGGT ATCGCCCGCT
  841 CCCGATTCGC AGCGCATCGC CTTCTATCGC CCTTCTTGAC GAGTTCTTCT GAGCGGGACT
  901 CTGGGGGTTC GAAATGACCG AACCAGCGAC GCCCAACCTG CATCACGAGA TTTCGATCAA
  961 CGGCGCTTCC TATGAAAGGT GGCTCCGATC GTTTTCCGGA CGCGCTGATG ATCTCAGCGC
1021 GGCAATCTCA TGCTGAGAGG T
//

Please visit Sequencing and PCR primers for primer information.


References

References

user report Shimizu, H., NF-kappaB plays an important role in indoxyl sulfate-induced cellular senescence, fibrotic gene expression, and inhibition of proliferation in proximal tubular cells. Am. J. Physiol. Cell Physiol. 301 (5): C1201-12 (2011). PMID 21832251.

2018.10.22

GNP_filter3_RDBDEP_html_181012.pl