Resource data sheet
Prev.
Please review the QC test results indicated by check icon below as well as clone information before placing your order.

pGEM3Zf_hssox15(R)

Plasmid clone of human SOX15 cDNA.

Catalog number RDB06676
Resource name pGEM3Zf_hssox15(R)
Alternative name SET-0235_26
Clone info. Plasmid clone of human SOX15 cDNA.
PCR cloning, forward primer: gcgctaccaggctcctcaca; reverse primer: gttagaggtgggttaggggcatg.
Vector backbone pGEM-3Zf(+) (Plasmid)
Selectable markers Amp^r
Gene/insert name Human SRY (sex determining region Y)-box 15 cDNA
Depositor|Developer Nakamura, Yukio |
 
Other clones in our bank human SOX15 (NCBI Gene 6665) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.
Ordering Please visit Information of Request for Distribution. 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA) [Word]
Distribution information (domestic users) [open/close]


Catalog # Resource name Availability Shipping form Fee (non-profit org.)
RDB06676 pGEM3Zf_hssox15(R) Under QC test. Please contact us. DNA solution

check Please wait for results of QC test to be uploaded. This clone will be sequenced a portion for examination.
Ordering Information [in Japanese] [in English]

References and tips

Electronic file

Original reference

Further references such as user reports and related articles (go to bottom)

Featured content


Sequence information

check Please wait for results of QC test to be uploaded. This clone will be sequenced a portion for examination.


References

Original, user report and related articles


2020.02.22

GNP_filter3_RDBDEP_html_191130.pl