Prev. |  KEGG KO K09271 > 

RIKEN DNA Bank Human Resource - SOX15

Gene ID NCBI Gene 6665 |  KEGG hsa:6665
Gene Symbol SOX15
Protein Name SRY-box transcription factor 15
Synonyms SOX20|SOX26|SOX27
Ortholog resource in our bank

  SOX15

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number Name of Resource Description
RDB06673 pGEM3Zf_hssox15(F) Plasmid clone of human SOX15 cDNA.
RDB06676 pGEM3Zf_hssox15(R) Plasmid clone of human SOX15 cDNA.
RDB06759 pCMFlag_hsSox15 Expression vector of human Sox15.

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001456 IRAK003K16 pCMV-SPORT6 BC000985 NM_006942 Full
HGY103283 IRAL058D11 pOTB7 BC072003 NM_006942 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE000817 W01A002A17 pENTR-TOPO IRAK003K16 BC000985 NM_006942  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR238699 ARiS096M11 pGCAP10 NM_006942.1  
GACAAACGCTGAGCCCAGGTGGGANAGGTCTGGCCTATCCGCGCCTGGCAGCTGTCGGAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl