Resource data sheet


Plasmid clone of human SOX15 cDNA

Catalog number RDB06673
Resource name pGEM3Zf_hssox15(F)
Alternative name SET-0235_15
Clone info. Plasmid clone of human SOX15 cDNA.
F-primer: gcgctaccaggctcctcaca; R-primer: gttagaggtgggttaggggcatg.
Vector backbone pGEM-3Zf(+) (Plasmid)
Selectable markers Amp^r
Gene/insert name Human SRY (sex determining region Y)-box 15 cDNA
Depositor Nakamura, Yukio |
Other clones in our bank human SOX15 (NCBI Gene 6665) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.
Ordering Please visit Information of Request for Distribution. 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA) [Word]
Distribution information (domestic users) [open/close]

Catalog # Resource name Shipping form Fee (non-profit org.)
RDB06673 pGEM3Zf_hssox15(F) DNA solution

Ordering Information [in Japanese] [in English]

References and tips

Electronic file

Featured content


User reports and related articles (go to bottom)

Sequence information

This clone will be sequenced a portion and digested by restriction enzyme for examination.


