Resource data sheet
Prev.
Please review the QC test results indicated by check icon below as well as clone information before placing your order.

pCMFlag_hsNFKBIA

Expression vector of human NFKBIA/IkappaB alpha.

Catalog number RDB06668
Resource name pCMFlag_hsNFKBIA
Alternative name SET-0206_4-1
Clone info. Expression vector of human NFKBIA/IkappaB alpha. Expression was confirmed by Western blotting with anti-FLAG antibody.
Derived from Sugano DMC05321. PCR cloning, forward primer: atgttccaggcggccgagcg; reverse primer: tgcactcataacgtcagacgctg. Nucleotide substitution T400C (silent) to NM_020529.
Vector backbone pCMV_S-FLAG (Plasmid)
Size of vector backbone 5.5 kb
Selectable markers Amp^r (E. coli), Neo^r (mammalian cell)
Gene/insert name Human NFKBIA/IkappaB alpha cDNA
Depositor|Developer DNA Bank, |
 
Other clones in our bank human NFKBIA (NCBI Gene 4792) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR The RECIPIENT agrees to describe RIKEN BRC as the source of the MATERIAL and cite Gene 200, 149-156, 1997 in any publication.
Ordering Please visit Information of Request for Distribution.[link] 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA) [Word]
Distribution information (domestic users) [open/close]


Catalog # Resource name Availability Shipping form Fee (non-profit org.)
RDB06668 pCMFlag_hsNFKBIA Under QC test. Please contact us. DNA solution

check Please wait for results of QC test to be uploaded. This clone will be sequenced a portion for examination.
Ordering Information [in Japanese] [in English]

References and tips

Electronic file

Electronic file Remarks, protocol and/or map (pdf) RDB06668.pdf

Original reference

Further references such as user reports and related articles (go to bottom)

Featured content

Featured content pCMV_tag and pRSV_tag assay-ready clones (English text)

Sequence information

check Please wait for results of QC test to be uploaded. This clone will be sequenced a portion for examination.


References

Original, user report and related articles

user report Rahimova, N., Development of mKO2 fusion proteins for real-time imaging and mechanistic investigation of the degradation kinetics of human IkappaBalpha in living cells. Biochim. Biophys. Acta Mol. Cell Res. 1866 (2): 190-198 (2018). PMID 30391277.

2020.10.02

GNP_filter3_RDBDEP_html_200316.pl