Resource data sheet
Prev.

pGEM3Zf_hsOct3/4isoform1(R)

Plasmid clone of human Oct3/4 isoform 1 cDNA

Catalog number RDB06603
Resource name pGEM3Zf_hsOct3/4isoform1(R)
Alternative name SET-0211_7-1
Clone info. Plasmid clone of human Oct3/4 isoform 1 cDNA.
F-primer: gcgggacacctggcttcggatt; R-primer: cctcagtttgaatgcatgggaga. Nucleotide substitution C843T (silent) and C1101T (silent) to NM_002701.4. iPS Yamanaka factor.
Vector backbone pGEM-3Zf(+) (Plasmid)
Selectable markers Amp^r
Gene/insert name Human Oct3/4 cDNA
Depositor Nakamura, Yukio |
 
Other clones in our bank human POU5F1 (NCBI Gene 5460) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.
Ordering Please visit Information of Request for Distribution. 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Distribution information (domestic users) [open/close]


Catalog # Resource name Shipping form Fee (non-profit org.)
RDB06603 pGEM3Zf_hsOct3/4isoform1(R) DNA solution

Ordering Information [in Japanese] [in English]

References and tips

Electronic file

Featured content

References

User reports and related articles (go to bottom)


Sequence information

This clone will be sequenced a portion and digested by restriction enzyme for examination.


References

References


2018.11.21

GNP_filter3_RDBDEP_html_181012.pl