Resource data sheet
Please review the QC test results indicated by check icon below as well as clone information before placing your order.


Plasmid clone of human Oct3/4 isoform 1 cDNA.

Catalog number RDB06429
Resource name pGEM3Zf_hsOct3/4isoform1(F)
Alternative name SET-0211_1-1
Clone info. Plasmid vector of human Oct3/4 isoform 1 cDNA.
PCR cloning, forward primer: gcgggacacctggcttcggatt; reverse primer: cctcagtttgaatgcatgggaga. Nucleotide substitution C843T (silent), A936G (silent) and C1101T (silent) to NM_002701.
Vector backbone pGEM-3Zf(+) (Plasmid)
Selectable markers Amp^r
Gene/insert name Human Oct3/4 cDNA
Depositor|Developer Nakamura, Yukio |
Other clones in our bank human POU5F1 (NCBI Gene 5460) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.
Ordering Please visit Information of Request for Distribution. 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Distribution information (domestic users) [open/close]

Catalog # Resource name Shipping form Fee (non-profit org.)
RDB06429 pGEM3Zf_hsOct3/4isoform1(F) DNA solution

Ordering Information [in Japanese] [in English]
Please review the QC test results indicated by check icon below as well as clone information before placing your order.

References and tips

Electronic file

Original reference

Further references such as user reports and related articles (go to bottom)

Featured content

Sequence information

RIKEN BRC has sequenced portions of this material for quality test.
Please review the QC test results indicated by check icon as well as clone information before placing your order.

Test sheet RDB12329_A3Kr.pdf check

Nucleotide sequence of a portion of this resource (if available).

Sequence file: RDB12329_A3Kra.seq check
Sequence file: RDB12329_A3Krb.seq check

Please visit Sequencing and PCR primers for primer information.


Original, user report and related articles
