Resource data sheet
Prev.

pGEM3Zf_hsOct3/4isoform1(F)

Plasmid clone of human Oct3/4 isoform 1 cDNA

Catalog number RDB06429
Resource name pGEM3Zf_hsOct3/4isoform1(F)
Alternative name SET-0211_1-1
Clone info. Plasmid vector of human Oct3/4 isoform 1 cDNA.
F-primer: gcgggacacctggcttcggatt; R-primer: cctcagtttgaatgcatgggaga. Nucleotide substitution C843T (silent), A936G (silent) and C1101T (silent) to NM_002701. iPS Yamanaka factor.
Vector backbone pGEM-3Zf(+) (Plasmid)
Selectable markers Amp^r
Gene/insert name Human Oct3/4 cDNA
Depositor Nakamura, Yukio |
 
Other clones in our bank human POU5F1 (NCBI Gene 5460) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.
Ordering Please visit Information of Request for Distribution. 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Distribution information (domestic users) [open/close]


Catalog # Resource name Shipping form Fee (non-profit org.)
RDB06429 pGEM3Zf_hsOct3/4isoform1(F) DNA solution

Ordering Information [in Japanese] [in English]

References and tips

Electronic file

Featured content

References

User reports and related articles (go to bottom)


Sequence information

RIKEN BRC has sequenced portions of this material for quality test. Primers and the results are shown below.

Data are summerized on test sheet below.

Test sheet RDB12329_A3Kr.pdf

Nucleotide sequence of a portion of this resource (if available).

Primer: RDB12329_A3Kra.seq
>06429_12329_A3Kr_M13(-40)_C10_07.ab1
    1 AGGGCCGTGT CATGTATACG ACTCACTATA GGGCGAATTC GAGCTCGGTA CCCGGGGATC
   61 CTCTAGAGTC CCTCAGTTTG AATGCATGGG AGAGCCCAGA GTGGTGACAG AGACAGGGGG
  121 AAAGGCTTCC CCCTCAGGGA AAGGGACCGA GGAGTACAGT GCAGTGAAGT GAGGGCTCCC
  181 ATAGCCTGGG GTACCAAAAT GGGGCCCTGG GGCCAGAGGA AAGGACACTG GTCCCCCTGA
  241 GAAAGGAGAC CCAGCAGCCT CAAAATCCTC TCGCTGTGCA TAGTCGCTGC TTGATCGCTT
  301 GCCCTTCTGG CGCCGGTTAC AGAACCACAC TCGGACCACA TCCTTCTCGA GCCCAAGCTG
  361 CTGGGCAATG TGGCTGATCT GCTGCAGTGT GGGTTTCGGG CACTGCAGGA ACAAATTCTC
  421 CAGGTTGCCT CTCACTCGGT TCTCGATACT GGTTCGCTTT CTCTTTCGGG CCTGCACGAG
  481 GGTTTCTGCT TTGCATATCT CCTGAAGATT TTCATTGTTG TCAGCTTCCT CCACCCACTT
  541 CTGCAGCAAG GGCCGCAGCT TACACATGTT CTTGAAGCTA AGCTGCAGAG CCTCAAAGCG
  601 GCAGATGGTC GTTTGGCTGA ATACCTTCCC AAATAGAACC CCCAGGGTGA GCCCCACATC
  661 GGCCTGTGTA TATCCCAGGG TGATCCTCTT CTGCTTCAGG AGCTTGGCAA ATTGCTCGAG
  721 TTCTTTCTGC AGAGCTTTGA TGTCCTGGGA CTCCTCCGGG TTTTGCTCCA GCTTCTCCTT
  781 CTCCAGCTTC ACGGCACCAG GGGTGACGGT GCAGGGCTCC GGGGAGGCCC CATCGGAGTT
  841 GCTCTCCACC CCGACTCCTG CTTCGCCCTC AGGCTGAGAG GTCTCCAAGC CGCCTTGGGG
  901 CACTAGCCCC ACTCCAACCT GGGGCCCACA GTACGCCATC CCCCCACAGA ACTCATACGG
  961 CGGGGGGCAT GGGGGAATCC CCCACACCTC AGAGCCTGGC CCAACCCCCG GGCCCGATTC
 1021 CTGGCCCTCC AGGAGGGCCT TGGAAGCTTA GCCAGGGTCC GGAGATCAAC CCAGCCCGGC
 1081 TCCGGCCCCC TGACCCATCA CTCACACTGA GGGGGCGAGA GCGAATCGGA GCAGTGTCCC
1141 GACTGCAGCA TGCAAGCTGA GTATTCTTAA TAGGTGTTCA CCCTA
//
Primer: RDB12329_A3Krb.seq
>06429_12329_A3Kr_Reverse2_D10_10.ab1
    1 CTTTACCGAA TTACGCCAGC TATTTAGGTG ACACTATAGA ATACTCAAGC TTGCATGCCT
   61 GCAGGTGCGG GACACCTGGC TTCGGATTTC GCCTTCTCGC CCCCTCCAGG TGGTGGAGGT
  121 GATGGGCCAG GGGGGCCGGA GCCGGGCTGG GTTGATCCTC GGACCTGGCT AAGCTTCCAA
  181 GGCCCTCCTG GAGGGCCAGG AATCGGGCCG GGGGTTGGGC CAGGCTCTGA GGTGTGGGGG
  241 ATTCCCCCAT GCCCCCCGCC GTATGAGTTC TGTGGGGGGA TGGCGTACTG TGGGCCCCAG
  301 GTTGGAGTGG GGCTAGTGCC CCAAGGCGGC TTGGAGACCT CTCAGCCTGA GGGCGAAGCA
  361 GGAGTCGGGG TGGAGAGCAA CTCCGATGGG GCCTCCCCGG AGCCCTGCAC CGTCACCCCT
  421 GGTGCCGTGA AGCTGGAGAA GGAGAAGCTG GAGCAAAACC CGGAGGAGTC CCAGGACATC
  481 AAAGCTCTGC AGAAAGAACT CGAGCAATTT GCCAAGCTCC TGAAGCAGAA GAGGATCACC
  541 CTGGGATATA CACAGGCCGA TGTGGGGCTC ACCCTGGGGG TTCTATTTGG GAAGGTATTC
  601 AGCCAAACGA CCATCTGCCG CTTTGAGGCT CTGCAGCTTA GCTTCAAGAA CATGTGTAAG
  661 CTGCGGCCCT TGCTGCAGAA GTGGGTGGAG GAAGCTGACA ACAATGAAAA TCTTCAGGAG
  721 ATATGCAAAG CAGAAACCCT CGTGCAGGCC CGAAAGAGAA AGCGAACCAG TATCGAGAAC
  781 CGAGTGAGAG GCAACCTGGA GAATTTGTTC CTGCAGTGCC CGAAACCCAC ACTGCAGCAG
  841 ATCAGCCACA TTGCCCAGCA GCTTGGGCTC GAGAAGGATG TGGTCCGAGT GTGGTTCTGT
  901 AACCGGCGCC AGAAGGGCAA GCGATCAAGC AGCGACTATG CACAGCGAGA GGATTTTGAG
  961 GCTGCTGGGG TCTCCTTTCT CACGGGGACC AGTGTCCTTT CCTCTGGGCC CCAGGGCCCC
 1021 ATTTTGGTAC CCCAGGCTAT GGGAGCCCTC ACTTTCACTG CACTGTACTC CTCGGTCCTT
 1081 TCCTGAGGGG GAAGCCTTTC CCCTGTCTCT TGTCACCACT CTGGGACTCC TCCCATGCAA
1141 TTTCAAACCT TGAAGGGGAA C
//

Please visit Sequencing and PCR primers for primer information.


References

References


2018.11.21

GNP_filter3_RDBDEP_html_181012.pl