Resource data sheet
Prev.

pGEM3Zf_hsc-Myc(alternative translation initiations from an upstream)

Plasmid clone of human MYC (alternative translation initiations from an upstream) cDNA

Catalog number RDB06428
Resource name pGEM3Zf_hsc-Myc(alternative translation initiations from an upstream)
Alternative name SET-0221_5
Clone info. Plasmid clone of human MYC (alternative translation initiations from an upstream) cDNA.
F-primer: ctggcccagccctcccgctgat; R-primer: ttacgcacaagagttccgtagct iPS Yamanaka factor.
Vector backbone pGEM-3Zf(+) (Plasmid)
Selectable markers Amp^r
Gene/insert name Human c-Myc cDNA
Depositor Nakamura, Yukio |
 
Other clones in our bank human MYC (NCBI Gene 4609) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.
Ordering Please visit Information of Request for Distribution. 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Distribution information (domestic users) [open/close]


Catalog # Resource name Shipping form Fee (non-profit org.)
RDB06428 pGEM3Zf_hsc-Myc(alternative translation initiations from an upstream) DNA solution

Ordering Information [in Japanese] [in English]

References and tips

Electronic file

Featured content

References

User reports and related articles (go to bottom)


Sequence information

This clone will be sequenced a portion and digested by restriction enzyme for examination.


References

References


2018.11.21

GNP_filter3_RDBDEP_html_181012.pl