DNA Bank Top |  KEGG KO K04377 > 

RIKEN DNA Bank Human Resource - MYC

Gene ID NCBI Gene 4609 |  KEGG hsa:4609
Gene Symbol MYC
Protein Name MYC proto-oncogene, bHLH transcription factor
Synonyms MRTL|MYCC|bHLHe39|c-Myc
Featured content Signaling pathways regulating pluripotency of stem cells (human)
Featured content Hippo signaling (human)
Featured content Wnt signaling pathway (human)
Featured content Jak-STAT signaling pathway (human)

Link

Ortholog resource in our bank

  MYC


External database

human MYC

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB18710 pC12 Plasmid clone of 798 bp human C12 sequence, which was isolated from MYC replication origin as a minimum sequence required for gene amplification.    
RDB12923 CSIV-TRE-hc-Myc-CMV-KT Lentivirus vector plasmid of human MYC driven by Tet-responsive promoter and hKO1-2A-rtTA driven by CMV promoter.    
RDB12919 CS-UbC-hc-Myc-IRES2-Venus Lentivirus vector plasmid of human MYC for generating iPS cells.    
RDB12911 CSII-EF-hc-Myc-IRES2-Venus Lentivirus vector plasmid of human MYC for generating iPS cells.    
RDB12902 CSII-CMV-hc-Myc-IRES2-Venus    
RDB08326 CSIV-CMV-hc-Myc-IRES2-Venus Lentivirus vector plasmid of human MYC for generating iPS cells.    
RDB07325 pGL4-phMYC Promoter collection, Human MYC promoter    
RDB07057 pAxEFFlag_hsc-Myc(alternative translation initiations from an upstream)it2 Shuttle vector to generate rAd harboring human c-Myc    
RDB07056 pAxEFFlag_hsc-Mycit2 Shuttle vector to generate rAd harboring human MYC    
RDB07025 pCMFlag_hsc-Myc (alternative translation initiations from an upstream) Expression vector of human c-Myc.    
RDB06671 pCMFlag_hsc-Myc Expression vector of human c-Myc.    
RDB06435 pENTR/hc-Myc Plasmid vector of human MYC    
RDB06432 pGEM3Zf_hsc-Myc Plasmid clone of human c-Myc cDNA.    
RDB06428 pGEM3Zf_hsc-Myc(alternative translation initiations from an upstream) Plasmid clone of human MYC (alternative translation initiations from an upstream) cDNA.    
RDB04659 pAxCALNLhc-Myc(forward) Shuttle vector to generate rAd expressing human MYC    
RDB04650 pAxCALNLhc-Myc(reverse) Shuttle vector to generate rAd expressing human MYC    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001281 IRAK003D09 pCMV-SPORT6 BC000141 NM_002467 Full/var
HGX001385 IRAK003H17 pCMV-SPORT6 BC000917 NM_002467 Full/var
HGX047822 IRAK119J06 pCMV-SPORT6 BC058901 NM_002467 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE023516 W01A058N04 pENTR-TOPO IRAK003D09 BC000141 NM_002467  
HGE023520 W01A058N08 pENTR-TOPO IRAK003D09 BC000141 NM_002467 done

♦ W series clone contains a stop codon.

GNP_entry_W01A_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR222219 ARiS055J03 pGCAP10 NM_002467.4  
GCCCCGAGCTGTGCTGCTCGCGGCCGCCACCGCCGGGCCCCGGCCGTCCCTGGCTCCCCT
HKR277710 ARiS194E14 pGCAP10 NM_002467.4  
GAACTCGCTGTAGTAATTCCAGCGAGAGGCAGAGGGAGCGAGCGGGCGGCCGGCTAGGGT
HKR471008 RBdS177I16 pGCAP10 NM_002467.4  
GAACTCGCTGTAGTAATTCCAGCGAGAGGCAGAGGGAGCGAGCGGGCGGCCGGCTAGGGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2025.03.19

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl