Prev. | Human A to Z list > M > 

RIKEN DNA Bank Human Resource - MYC

Gene ID (NCBI) 4609
Gene Symbol MYC
Protein Name MYC proto-oncogene, bHLH transcription factor
Synonyms MRTL|MYCC|bHLHe39|c-Myc
Databases KEGG hsa:4609 |  NCBI Gene 4609
Featured content Signaling pathways regulating pluripotency of stem cells (human)
Featured content Hippo signaling (human)
Featured content Wnt signaling pathway (human)
Featured content Jak-STAT signaling pathway (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K04377)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04659 pAxCALNLhc-Myc(forward) Shuttle vector to generate rAd expressing human MYC
RDB04650 pAxCALNLhc-Myc(reverse) Shuttle vector to generate rAd expressing human MYC
RDB06428 pGEM3Zf_hsc-Myc(alternative translation initiations from an upstream) Plasmid clone of human MYC (alternative translation initiations from an upstream) cDNA
RDB06432 pGEM3Zf_hsc-Myc Plasmid clone of human c-Myc cDNA
RDB06435 pENTR/hc-Myc Plasmid vector of human MYC
RDB06671 pCMFlag_hsc-Myc Expression vector of human c-Myc
RDB07025 pCMFlag_hsc-Myc (alternative translation initiations from an upstream) Expression vector of human c-Myc
RDB07056 pAxEFFlag_hsc-Mycit2 Shuttle vector to generate rAd harboring human MYC
RDB07057 pAxEFFlag_hsc-Myc(alternative translation initiations from an upstream)it2 Shuttle vector to generate rAd harboring human c-Myc
RDB07325 pGL4-phMYC Promoter collection, Human MYC promoter

RDB_org_170226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX001281 IRAK003D09 pCMV-SPORT6 BC000141 NM_002467 Full/var
HGX001385 IRAK003H17 pCMV-SPORT6 BC000917 NM_002467 Full/var
HGX047822 IRAK119J06 pCMV-SPORT6 BC058901 NM_002467 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE023516 W01A058N04 pENTR-TOPO IRAK003D09 BC000141 NM_002467  
HGE023520 W01A058N08 pENTR-TOPO IRAK003D09 BC000141 NM_002467 done

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR222219 ARiS055J03 pGCAP10 NM_002467.4  
GCCCCGAGCTGTGCTGCTCGCGGCCGCCACCGCCGGGCCCCGGCCGTCCCTGGCTCCCCT
HKR277710 ARiS194E14 pGCAP10 NM_002467.4  
GAACTCGCTGTAGTAATTCCAGCGAGAGGCAGAGGGAGCGAGCGGGCGGCCGGCTAGGGT
HKR471008 RBdS177I16 pGCAP10 NM_002467.4  
GAACTCGCTGTAGTAATTCCAGCGAGAGGCAGAGGGAGCGAGCGGGCGGCCGGCTAGGGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.06.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl