Resource data sheet
Prev.
Please review the QC test results indicated by check icon below as well as clone information before placing your order.

pCMFlag_hsSTAT6

Expression vector of human STAT6.

Catalog number RDB06383
Resource name pCMFlag_hsSTAT6
Alternative name SET-0181_9
Clone info. Expression vector of human STAT6. Expression was confirmed by Western blotting with anti-FLAG antibody.
Derived from Sugano BC075852. PCR cloning, forward primer: atgtctctgtggggtctggtctcc; reverse primer: gatcaccaactggggttggc.
Vector backbone pCMV_S-FLAG (Plasmid)
Size of vector backbone 5.5 kb
Selectable markers Amp^r (E. coli), Neo^r (mammalian cell)
Gene/insert name Human STAT6 cDNA
Depositor|Developer DNA Bank, |
 
Other clones in our bank human STAT6 (NCBI Gene 6778) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR The RECIPIENT agrees to describe RIKEN BRC as the source of the MATERIAL and cite Gene 200, 149-156, 1997 in any publication.
Ordering Please visit Information of Request for Distribution. 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA) [Word]
Distribution information (domestic users) [open/close]


Catalog # Resource name Shipping form Fee (non-profit org.)
RDB06383 pCMFlag_hsSTAT6 DNA solution

Ordering Information [in Japanese] [in English]
Please review the QC test results indicated by check icon below as well as clone information before placing your order.

References and tips

Electronic file

Original reference

Further references such as user reports and related articles (go to bottom)

Featured content

Featured content pCMV_tag and pRSV_tag assay-ready clones (English text)

Sequence information

RIKEN BRC has sequenced portions of this material for quality test.
Please review the QC test results indicated by check icon as well as clone information before placing your order.

Test sheet RDB06383_A3Ir.pdf check

Nucleotide sequence of a portion of this resource (if available).

Primer:
Sequence file: RDB06383_A3Ira.seq check
>06383_06383_A3Ir_2_CMV-Foward_A04_01.ab1
    1 AGTTCCCCTC CGCCCCATTG ACGCAATGGG CGGTAGGCGT GTACGGTGGG AGGTCTATAT
   61 AAGCAGAGCT CTCTGGCTAA CTAGAGAACC CACTGCTTAC TGGCTTATCG AAATTAATAC
  121 GACTCACTAT AGGGAGACCC AAGCTGAATT CACCATGGAC TACAAGGACG ATGACGATAA
  181 GGCGGCCATG TCTCTGTGGG GTCTGGTCTC CAAGATGCCC CCAGAAAAAG TGCAGCGGCT
  241 CTATGTCGAC TTTCCCCAAC ACCTGCGGCA TCTTCTGGGT GACTGGCTGG AGAGCCAGCC
  301 CTGGGAGTTC CTGGTCGGCT CCGACGCCTT CTGCTGCAAC TTGGCTAGTG CCCTACTTTC
  361 AGACACTGTC CAGCACCTTC AGGCCTCGGT GGGAGAGCAG GGGGAGGGGA GCACCATCTT
  421 GCAACACATC AGCACCCTTG AGAGCATATA TCAGAGGGAC CCCCTGAAGC TGGTGGCCAC
  481 TTTCAGACAA ATACTTCAAG GAGAGAAAAA AGCTGTTATG GAACAGTTCC GCCACTTGCC
  541 AATGCCTTTC CACTGGAAGC AGGAAGAACT CAAGTTTAAG ACAGGCTTGC GGAGGCTGCA
  601 GCACCGAGTA GGGGAGATCC ACCTTCTCCG AGAAGCCCTG CAGAAGGGGG CTGAGGCTGG
661 CCAAGTGTCT CT
//
Primer:
Sequence file: RDB06383_A3Irb.seq check
>06383_06383_A3Ir_2_Sp6_B04_04.ab1
    1 CCGAGAATCT GCTCGAGCGG CCGATCACCA ACTGGGGTTG GCCCTTAGGT CCATGTGGGA
   61 CATTGAGATC CCAGATTGCC CATAGTGGGA GGGCTGCAGG AGGGGCTGTG CCCCCAAGGA
  121 CCCTCCCCCC GACTCCCCTT GCCCCTCCAG GAGAAGCTTA GTGAGGTCCT GTTCAGTGGG
  181 AGGCAGCAGA GGAGGGAATA TGTCTTCACC AATCCAAGTG CCCTGAGGAA ACGCTGTCAC
  241 TGGCTGGCTC AGGCAGCTGT CTTCCACCAT GGTCACATCT GAGCAGAGCA GGGGGTCAGG
  301 GCTGGACACA GCATGCTCCT GAGGCTGGCA CGGCAGCAGG CCCTGGGGGT GAGGCTGGTC
  361 AAAGGGCAGG CTCATCTGGC CCAGGCTGGG GGGCATCTGC AGGTGAGGCT CCTGGAAGGC
  421 TGACAACACG TTGACTGATT CTTCTGGGGA GAGGCCTTGA TACGGGGGGA TGGAGTGAGA
  481 GTGTGGTGGG TACACCTGGG GCACCATATC TGGGCCAAGC TGCATGCTCA TGGAGGAATC
  541 AGGGGCCATT CCAAGGTCAT AAGAAGGCAC CATGGTAGGC ATCTGGAGCT CTGGGGTAGG
  601 AAGTGGTTGG TCCCTTTCCA CGGTCATCTT GATGGTAGCT GGGACATAAC CCCTGCCATC
661 CTTACCCATC TGTTC
//

Please visit Sequencing and PCR primers for primer information.


References

Original, user report and related articles


2020.02.22

GNP_filter3_RDBDEP_html_191130.pl