Resource data sheet
Prev.
Please review the QC test results indicated by check icon below as well as clone information before placing your order.

pCMFlag_hsSTAT1

Expression vector of human STAT1.

Catalog number RDB06381
Resource name pCMFlag_hsSTAT1
Alternative name SET-0178_4
Clone info. Expression vector of human STAT1. Expression was confirmed by Western blotting with anti-FLAG antibody.
Derived from Sugano BC002704. PCR cloning, forward primer: atgtctcagtggtacgaact; reverse primer: ttacacttcagacacagaaatc.
Vector backbone pCMV_S-FLAG (Plasmid)
Size of vector backbone 5.5 kb
Selectable markers Amp^r (E. coli), Neo^r (mammalian cell)
Gene/insert name Human STAT1 cDNA
Depositor|Developer DNA Bank, |
 
Other clones in our bank human STAT1 (NCBI Gene 6772) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR The RECIPIENT agrees to describe RIKEN BRC as the source of the MATERIAL and cite Gene 200, 149-156, 1997 in any publication.
Ordering Please visit Information of Request for Distribution.[link] 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA) [Word]
Distribution information (domestic users) [open/close]


Catalog # Resource name Availability Shipping form Fee (non-profit org.)
RDB06381 pCMFlag_hsSTAT1 Under QC test. Please contact us. DNA solution

check Please wait for results of QC test to be uploaded. This clone will be sequenced a portion for examination.
Ordering Information [in Japanese] [in English]

References and tips

Electronic file

Original reference

Further references such as user reports and related articles (go to bottom)

Featured content

Featured content pCMV_tag and pRSV_tag assay-ready clones (English text)

Sequence information

check Please wait for results of QC test to be uploaded. This clone will be sequenced a portion for examination.


References

Original, user report and related articles


2020.10.02

GNP_filter3_RDBDEP_html_200316.pl