Resource data sheet
Prev.

pCMFlag_hsESRRA

Expression vector of human ESRRA

Catalog number RDB06260
Resource name pCMFlag_hsESRRA
Alternative name SET-0032_4
Clone info. Expression vector of human ESRRA. Expression was confirmed by Western blotting with anti-FLAG antibody.
F-primer: atgtccagccaggtggtgggc; R-primer: tcagtccatcatggcctcgagc.
Vector backbone pCMV_S-FLAG (Plasmid)
Size of vector backbone 5.5 kb
Selectable markers Amp^r (E. coli), Neo^r (mammalian cell)
Gene/insert name Human ERR alpha cDNA
Depositor DNA Bank, |
 
Other clones in our bank human ESRRA (NCBI Gene 2101) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR The RECIPIENT agrees to describe RIKEN BRC as the source of the MATERIAL in any publication.
Ordering Please visit Information of Request for Distribution. 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA) [Word]
Distribution information (domestic users) [open/close]


Catalog # Resource name Shipping form Fee (non-profit org.)
RDB06260 pCMFlag_hsESRRA DNA solution

Ordering Information [in Japanese] [in English]

References and tips

Electronic file

Electronic file PDF RDB06260.pdf from Depositor

Featured content

Featured content pCMV_tag and pRSV_tag assay-ready clones (English text)

References

User reports and related articles (go to bottom)


Sequence information

RIKEN BRC has sequenced portions of this material for quality test. Primers and the results are shown below.

Data are summerized on test sheet below.

Test sheet RDB12739_A7Jbp1.pdf

Nucleotide sequence of a portion of this resource (if available).

Primer: CMV-Forward RDB12739_A7Jba.seq
>06260_12739_A7Jb_CMV-Forward_A01_01_ABI08.ab1
    1 AGTGTTCAAC TCCGCCCCAT TGACGCAATG GGCGGTAGGC GTGTACGGTG GGAGGTCTAT
   61 ATAAGCAGAG CTCTCTGGCT AACTAGAGAA CCCACTGCTT ACTGGCTTAT CGAAATTAAT
  121 ACGACTCACT ATAGGGAGAC CCAAGCTGAA TTCACCATGG ACTACAAGGA CGATGACGAT
  181 AAGGCGGCCA TGTCCAGCCA GGTGGTGGGC ATTGAGCCTC TCTACATCAA GGCAGAGCCG
  241 GCCAGCCCTG ACAGTCCAAA GGGTTCCTCG GAGACAGAGA CCGAGCCTCC TGTGGCCCTG
  301 GCCCCTGGTC CAGCTCCCAC TCGCTGCCTC CCAGGCCACA AGGAAGAGGA GGATGGGGAG
  361 GGGGCTGGGC CTGGCGAGCA GGGCGGTGGG AAGCTGGTGC TCAGCTCCCT GCCCAAGCGC
  421 CTCTGCCTGG TCTGTGGGGA CGTGGCCTCC GGCTACCACT ATGGTGTGGC ATCCTGTGAG
  481 GCCTGCAAAG CCTTCTTCAA GAGGACCATC CAGGGGAGCA TCGAGTACAG CTGTCCGGCC
  541 TCCAACGAGT GTGAGATCAC CAAGCGGAGA CGCAAGGCCT GCCAGGCCTG CCGCTTCACC
  601 AAGTGCCTGC GGGTGGGCAT GCTCAAGGAG GGAGTGCGCC TGGACCGCGT CCGGGGTGGG
  661 CGGCAGAAGT ACAAGCGGCG GCCGGAGGTG GACCCACTGC CCTTCCCGGG CCCCTTCCCT
  721 GCTGGGCCCC TGGCAGTCGC TGGAGGCCCC CGGAAGACAG CAGCCCCAGT GAATGCACTG
  781 GTGTCTCATC TGCTGGTGGT TGAGCCTGAG AAGCTCTATG CCATGCCTGA CCCCGCAGGC
  841 CCTGATGGGC ACCTCCCAGC CGTGGCTACC CTCTGTGACC TCTTTGACCG AGAGATTGTG
  901 GTCACCATCA GCTGGGCCAA GAGCATCCCA GGCTTCTCAT CGCTGTCGCT GTCTGACCAG
  961 ATGTCAGTAC TGCAGAGCGT GTGGATGGAG GGTGCTGGTG CTGGTGTGGC CCAGCGCTCA
 1021 CTGCCACTGC AGGATGAGCT GGCCCTTCGC TGAGGACTTA GTCCCTGGGA ATGAAGGAGG
 1081 GGCACGGGCA GGCTGCCTGG GGACCTGGGG GGGCTGCCCT GCTGCAACTA AGTGGCGGGG
1141 CCGGGCATC
//
Primer: BGH_rev2 RDB12739_A7Jbb.seq
>06260_12739_A7Jb_BGH_rev2_B01_02_ABI08.ab1
    1 ACAATAACTA ATGTTGATGA GCACAGCGGG AGGGGCAAAC AACAGATGGC TGGCAACTAG
   61 AAGGCACAGT CGAGGCTGAT CAGCGAGCTC TAGCATTTAG GTGACACTAT AGAATAGGGC
  121 CCTCTAGATG CATGCTCGAG CGGCCTCAGT CCATCATGGC CTCGAGCATC TCCAAGAACA
  181 GCTTGTGCAT GGGCACCTTG CCCTCCAGCT TCACCCCATA GAAATGGGCC AGCACTTTGC
  241 CCGCTGTCTG GCGGAGGAGC GGTAGCGTGA GCAGCAGCCT GCCCGCCCGC CGCCGCTCAG
  301 CACCCCCTCC GGGGCCAGCC CGGCCGGCTT CATACTCCAG CAGGGCCTCG TGCAGAGCTT
  361 CTCGCAGCTG CTCCACAGCC TCGGCATCTT CGATGTGCAC AGAGTCTGAA TTGGCAAGGG
  421 CCAAGGCCTT TAGTAGAACA TACTCCTCTC GCTCCAGCCG CAGGGCCTGC AGCCGCCGCA
  481 CTAGTTGCAG CAGGGCAGCC CCCAGTTCCC CCAGGCCAGC TGCCCGTGCC CCCTCTTCAT
  541 CCAGGACTAA GTCCTCAGCG AAGGCCAGCT CATCCTGCAG TGGCAGTGAG CGCTGGGCCA
  601 CACCCAGCAC CAGCACCTCC ATCCACACGC TCTGCAGTAC TGACATCTGG TCAGACAGCG
  661 ACAGCGATGA GAAGCCTGGG ATGCTCTTGG CCCAGCTGAT GGTGACCACA ATCTCTCGGT
  721 CAAAGAGGTC ACAGAGGGTA GCCACGGCTG GGAGGTGCCC ATCAGGGCCT GCGGGGTCAG
  781 GCATGGCATA GAGCTTCTCA GGCTCAACCA CCAGCAGATG AGACACCAGT GCATTCACTG
  841 GGGGCTGCTG TCTTCCGGGG GCCTCCAGCG ACTGCCAGGG GCCCAGCAAG GGAAGGGGCC
  901 CGGGAAGGGC AGTGGGTCCA CCTCCGGCCG CCGCTTGTAC TTCTGCCGCC CACCCCGGGA
  961 CGCGGTCCAG GCGCACTCCC TCCTTGAGCA TGCCCACCCG CAGGCACTTG GTGAAGCGGC
 1021 AGGCCTGGCA AGCCCTTGCG TCTCCGCTTG GTGATCTCAC ACTCGTTGGA GCGGGACAGC
1081 TGTACTTCGA ATGCTCCCTG AATGATCTCT TGGAAGAAGC TTTTGGCCAA GGCTCA
//
Primer: SV40pro_F_V2 RDB12739_A7Jbc.seq
>06260_12739_A7Jb_SV40pro_F_V2_F09_18_ABI24.ab1
    1 TTCAGACGTT TTTTTGGAGG CTAGGCTTTT GCAAAAGCTC CCGGGAGCTT GGATATCCAT
   61 TTTCGGATCT GATCAAGAGA CAGGATGAGG ATCGTTTCGC ATGATTGAAC AAGATGGATT
  121 GCACGCAGGT TCTCCGGCCG CTTGGGTGGA GAGGCTATTC GGCTATGACT GGGCACAACA
  181 GACAATCGGC TGCTCTGATG CCGCCGTGTT CCGGCTGTCA GCGCAGGGGC GCCCGGTTCT
  241 TTTTGTCAAG ACCGACCTGT CCGGTGCCCT GAATGAACTG CAGGACGAGG CAGCGCGGCT
  301 ATCGTGGCTG GCCACGACGG GCGTTCCTTG CGCAGCTGTG CTCGACGTTG TCACTGAAGC
  361 GGGAAGGGAC TGGCTGCTAT TGGGCGAAGT GCCGGGGCAG GATCTCCTGT CATCTCACCT
  421 TGCTCCTGCC GAGAAAGTAT CCATCATGGC TGATGCAATG CGGCGGCTGC ATACGCTTGA
  481 TCCGGCTACC TGCCCATTCG ACCACCAAGC GAAACATCGC ATCGAGCGAG CACGTACTCG
  541 GATGGAAGCC GGTCTTGTCG ATCAGGATGA TCTGGACGAA GAGCATCAGG GGCTCGCGCC
  601 AGCCGAACTG TTCGCCAGGC TCAAGGCGCG CATGCCCGAC GGCGAGGATC TCGTCGTGAC
  661 CCATGGCGAT GCCTGCTTGC CGAATATCAT GGTGGAAAAT GGCCGCTTTT CTGGATTCAT
  721 CGACTGTGGC CGGCTGGGTG TGGCGGACCG CTATCAGGAC ATAGCGTTGG CTACCCGTGA
  781 TATTGCTGAA GAGCTTGGCG GCGAATGGGC TGACCGCTTC CTCGTGCTTT ACGGTATCGC
  841 CGCTCCCGAT TCGCAGCGCA TCGCCTTCTA TCGCCTTCTT GACGAGTTCT TCTGAGCGGG
  901 ACTCTGGGGG TTCGAAATGA CCGACCAAGC GACGCCCAAC CCTGCCATCA CGAGATTTCG
  961 ATTCCACCGC CCGCCCTTTC TATGAAGGTT GGGCTTTCGG AATCGTTTTC CTGGACGCCC
 1021 GGCTGGATGA ATCTCAGCGC GGGGATCTCA TGCTTGGAAG TCATCGCCCA CCCCAACTGT
1081 TATGGCAGCC TATATTGGTT ACGAATAAGG CAATATAGCC
//

Please visit Sequencing and PCR primers for primer information.


References

References

user report Igarashi, J., A key role of PGC-1alpha transcriptional coactivator in production of VEGF by a novel angiogenic agent COA-Cl in cultured human fibroblasts. Physiol. Rep. 4 (6). pii: e12742 (2016). PMID 27033444.

2018.10.22

GNP_filter3_RDBDEP_html_181012.pl