Resource data sheet
Please review the QC test results indicated by check icon below as well as clone information before placing your order.


Expression vector of human ESRRA.

Catalog number RDB06260
Resource name pCMFlag_hsESRRA
Alternative name SET-0032_4
Clone info. Expression vector of human ESRRA. Expression was confirmed by Western blotting with anti-FLAG antibody.
PCR cloning, forward primer: atgtccagccaggtggtgggc; reverse primer: tcagtccatcatggcctcgagc.
Vector backbone pCMV_S-FLAG (Plasmid)
Size of vector backbone 5.5 kb
Selectable markers Amp^r (E. coli), Neo^r (mammalian cell)
Gene/insert name Human ERR alpha cDNA
Depositor|Developer DNA Bank, |
Other clones in our bank human ESRRA (NCBI Gene 2101) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR The RECIPIENT agrees to describe RIKEN BRC as the source of the MATERIAL in any publication.
Ordering Please visit Information of Request for Distribution. 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA) [Word]
Distribution information (domestic users) [open/close]

Catalog # Resource name Shipping form Fee (non-profit org.)
RDB06260 pCMFlag_hsESRRA DNA solution

Ordering Information [in Japanese] [in English]
Please review the QC test results indicated by check icon below as well as clone information before placing your order.

References and tips

Electronic file

Electronic file Remarks, protocol and/or map (pdf) RDB06260.pdf

Original reference

Further references such as user reports and related articles (go to bottom)

Featured content

Featured content pCMV_tag and pRSV_tag assay-ready clones (English text)

Sequence information

RIKEN BRC has sequenced portions of this material for quality test.
Please review the QC test results indicated by check icon as well as clone information before placing your order.

Test sheet RDB12739_A7Jbp1.pdf check

Nucleotide sequence of a portion of this resource (if available).

Primer: CMV-Forward
Sequence file: RDB12739_A7Jba.seq check
Primer: BGH_rev2
Sequence file: RDB12739_A7Jbb.seq check
Primer: SV40pro_F_V2
Sequence file: RDB12739_A7Jbc.seq check

Please visit Sequencing and PCR primers for primer information.


Original, user report and related articles

user report Igarashi, J., A key role of PGC-1alpha transcriptional coactivator in production of VEGF by a novel angiogenic agent COA-Cl in cultured human fibroblasts. Physiol. Rep. 4 (6). pii: e12742 (2016). PMID 27033444.
