Prev. |  KEGG KO K08552 > 

RIKEN DNA Bank Human Resource - ESRRA

Gene ID NCBI Gene 2101 |  KEGG hsa:2101
Gene Symbol ESRRA
Protein Name estrogen related receptor alpha
Synonyms ERR1|ERRa|ERRalpha|ESRL1|NR3B1
Ortholog resource in our bank

  ESRRA

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB06260 pCMFlag_hsESRRA Expression vector of human ESRRA.

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX005260 IRAK013C12 pCMV-SPORT6 BC011528 NM_004451 Partial
HGX027216 IRAK068A16 pCMV-SPORT6 BC033701 NM_004451 Partial/var
HGX056688 IRAK141L24 pCMV-SPORT6 BC063795 NM_004451 Full
HGX069717 IRAK174E21 pCMV-SPORT6 BC073956 NM_004451
HGY088323 IRAL020N11 pOTB7 BC007915 NM_004451 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE011373 W01A028H05 pENTR-TOPO IRAK141L24 BC063795 NM_004451 done

♦ W series clone contains a stop codon.

GNP_entry_W01A_2022Apr03.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR120801 ARh02A01 pGCAP1 NM_004451.3  
GAGTCCGGGCCACGGTTGGGACCCAGTCGAGGGTCGGACTGNTCAGGGTTCAGGCGGGAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.05.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl