Resource data sheet
Prev.
Please review the QC test results indicated by check icon below as well as clone information before placing your order.

pKM2L-pvMMTV

Promoter Bank clone, MMTV promoter

Catalog number RDB05825
Resource name pKM2L-pvMMTV
Alternative name p2009-59
Clone info. The MMTV promoter sequence (PCR-amplified 1,320 bp) was inserted into a Renilla luciferase reporter vector pKM2L (RDB04026).
Forward primer, 2009F: 5' aagcttgggcagaaatggttgaac 3'; Reverse primer, 2009R: 5' tgccgcagtcggccgacctgaggg 3' Entire sequence of promoter region has not been confirmed.
Vector backbone pKM2L (RDB04026) (Plasmid)
Selectable markers Kan^r
Gene/insert name MMTV MMTV genomic DNA
Reference of nucleotide sequence M15122 (DDBJ accession number)
Depositor|Developer DNA Bank, |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR 1. The RECIPIENT agrees to use the BIOLOGICAL RESOURCE only for academic research in the non-profit organization. 2. In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.
Additional terms and conditions for distribution The use of the BIOLOGICAL RESOURCE is restricted to the academic researches conducted by non-profit organization. By using this material, the RECIPIENT agrees to be bound by the conditions of the limited use statement of the Promega Corporation.
Ordering Please visit Information of Request for Distribution.[link] 
Order form 
[Credit Card Payment]  [Bank Transfer Payment]
Material Transfer Agreement (MTA for use for not-for-profit academic purpose) [Word]
Distribution information (domestic users) [open/close]


Catalog # Resource name Shipping form Fee (non-profit org.)
RDB05825 pKM2L-pvMMTV DNA solution

Ordering Information [in Japanese] [in English]
Please review the QC test results indicated by check icon below as well as clone information before placing your order.

References and tips

Electronic file

Original reference

Further references such as user reports and related articles (go to bottom)

Featured content


Sequence information

RIKEN BRC has sequenced portions of this material for quality test.
Please review the QC test results indicated by check icon as well as clone information before placing your order.

Test sheet RDB05825_A4K4.pdf check

Nucleotide sequence of a portion of this resource (if available).

Primer: M13_-40
Sequence file: RDB05825_A4K4a.seq check
>05825_05825_A4K4_3_M13_-40_C07_07.ab1
    1 CGGCAAGGCA GCTTGCATGC CTGCAGGTCA TTTAAATAGG GATAACAGGG TAATGATTAA
   61 GATCTCGAGC TCTAAGCTTC ACATATGCAT GCACTAGTGG CAAGCTTGGG CAGAAATGGT
  121 TGAACTCCCG AGAGTGTCCT ACACCTAGGG GAGAAGCAGC CAAGGGGTTG TTTCCCACCA
  181 AGGACGACCC GTCTGCGCAC AAACGGATGA GCCCATCAGA CAAAGACATA TTCATTCTCT
  241 GCTGCAAACT TGGCATAGCT CTGCTTTGCC TGGGGCTATT GGGGGAAGTT GCGGTTCGTG
  301 CTCGCAGGGC TCTCACCCTT GACTCTTTTA ATAGCTCTTC TGTGCAAGAT TACAATCTAA
  361 ACAATTCGGA GAACTCGACC TTCCTCCTGA GGCAAGGACC ACAGCCAACT TCCTCTTACA
  421 AGCCGCATCG ATTTTGTCCT TCAGAAATAG AAATAAGAAT GCTTGCTAAA AATTATATTT
  481 TTACCAATAA GACCAATCCA ATAGGTAGAT TATTAGTTAC TATGTTAAGA AATGAATCAT
  541 TATCTTTTAG TACTATTTTT ACTCAAATTC AGAAGTTAGA AATGGGAATA GAAAATAGAA
  601 AGAGACGCTC AACCTCAATT GAAGAACAGG TGCAAGGACT ATTGACCACA GGCCTAGAAG
  661 TAAAAAAGGG AAAAAAGAGT GTTTTTGTCA AAATAGGAGA CAGGTGGTGG CAACCAGGGA
  721 CTTATAGGGG ACCTTACATC TACAGACCAA CAGATGCCCC CTTACCATAT ACAGGAAGAT
  781 ATGACTTAAA TTGGGATAGG TGGGTTACAG TCAATGGCTA TAAAGTGTTA TATAGATCCC
  841 TCCCTTTTCG TGAAAGACTC GCCAGAGCTA GACCTCCTTG GTGTATGTTG TCTCAAGAAG
  901 AAAAAGACGA CATGAAACAA CAGGTACATG ATTATATTTA TCTAGGAACA GGAATGCACT
  961 TTTTGGGGAA AGATTTTCCA TACCAAGGAG GGGACAGTGG CTGGACTAAT AGAACATTAT
 1021 TTCTGCAAAA ACTCATGGCA TGAGTTATTA TGATAGCCTT TATTTGACCC ATCTTGCGAT
 1081 TCCAGGCTTT AAGTAAGGTT TTTTGATTAC CAAACCTGAT TCTAACGAGG CATGTGAGAC
1141 ATGATTCTTG ACCTTGGAAT TTGC
//
Primer: phRLR2
Sequence file: RDB05825_A4K4b.seq check
>05825_05825_A4K4_3_phRLR2_D07_10.ab1
    1 ACCTTCTCCG TCTCGAAAGC CCAGTTTCTA TTGGTCTCCT TAAACCTGTC TTGTAACCTT
   61 GATACTTACC TGCCCAGTGC CTCACGACCA ACTTCTGCAG TACCCGGGTG AATTCTACGC
  121 GTCGACAGGC TGCCGCAGTC GGCCGACCTG AGGGTCGCCG GGGTCTGCGG GGGGACCCTC
  181 TGGAAAGTGA AGGATAAGTG ACGAGCGGAG ACGGGATGGC GAACAGACAC AAACACACAA
  241 GAGGTGAATG TTAGGACTGT TGCAAGTTTA CTCAAAAAAT CAGCACTCTT TTATATCTTG
  301 GTTTACATAA GCATTTACAT AAGATTTGGA TAAATTCCAA AAGAACATAG GAAAATAGAA
  361 CACTCAGAGC TCAGATCAGA ACCTTTGATA CCAAACCAAG TCAGGAAACC ACTTGTCTCA
  421 CATCCTCGTT TTAAGAACAG TTTGTAACCA AAAACTTACT TAAGCCCTGG GAACCGCAAG
  481 GTTGGGCCAA TAAAGGCTAT TCATAATAAC TCATGCCATG AGTTTTTGCA GAATAATGTT
  541 CTATTAGTCC AGCCACTGTC CCCTCCTTGG TATGGAAAAT CTTTCCCCAA AAGTGCATTC
  601 CTGTTCCTAG ATAAATATAA TCATGTACCT GTTGTTTCAT GTCGTCTTTT TCTTCTTGAG
  661 ACAACATACA CCAAGGAGGT CTAGCTCTGG CGAGTCTTTC ACGAAAAGGG AGGGATCTAT
  721 ATAACACTTT ATAGCCATTG ACTGTAACCC ACCTATCCCA ATTTAAGTCA TATCTTCCTG
  781 TATATGGTAA GGGGGCATCT GTTGGTCTGT AGATGTAAAG GTCCCCTATA AGTCCCTGGT
  841 TGCCACCACC TGTCTCCTAT TTTGACAAAA ACACTCTTTT TTCCCTTTTT TACTTCTAGG
  901 CCTGTGGTCA TAGTCCTTGC ACCTGTTCTT CAATTGAGTT GAGCGTCTCT TTCTATTTTC
  961 TATTCCCATT TCTAACTTCT GAATTTGAGT AAAAAATAGT ACTAAAAGGA TATGATCATT
 1021 TCTTACATAG TAACTAATTA ATCTAACTAA TGATGTCTTA TTGGTAAAAT ATAATTTTAG
 1081 CCAGCCATTC CTATTCATTT CTGAGACAAT TCGAATGCCG CCTTGTAAGA GGAAAGTTGT
1141 GG
//

Please visit Sequencing and PCR primers for primer information.


References

Original, user report and related articles

user report Oasa, S., Relationship Between Homodimeric Glucocorticoid Receptor and Transcriptional Regulation Assessed via an In Vitro Fluorescence Correlation Spectroscopy-Microwell System. Sci. Rep. 8 (1): 7488 (2018). PMID 29748590.

2021.07.10

GNP_filter3_RDBDEP_html_210618.pl