Resource data sheet
Please review the QC test results indicated by check icon below as well as clone information before placing your order.


Promoter Bank clone, Human c-kit promoter

Catalog number RDB05812
Resource name pKM2L-phKIT
Alternative name p2007-39F
Clone info. PCR amplified human c-kit promoter sequence was inserted into a Renilla luciferase reporter vector pKM2L (RDB04026). Cloned fragment: 54657684 to 54658014(NC_000004.12); relatively -244 to +87, where +1 corresponds to 1 nt of NM_000222.2.
PCR cloning, forward primer, 2007F2- SpeI: 5' gatcactagtaggggtggaaaggtggagagaga 3'; reverse primer, 2007R2- SalI: 5' gatcgtcgaccgcggtagctgcgatgggat 3' (reference: Jpn. J. Cancer Res., 84, 1136-1144, 1993, PMID:7506248)
Vector backbone pKM2L (RDB04026) (Plasmid)
Size of vector backbone 4.2 kb
Selectable markers Kan^r
Gene/insert name Human c-kit genomic DNA
Reference of nucleotide sequence AC006552 (DDBJ accession number)
Depositor|Developer DNA Bank, |
Other clones in our bank human KIT (NCBI Gene 3815) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR 1. The RECIPIENT agrees to use the BIOLOGICAL RESOURCE only for academic research in the non-profit organization. 2. In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.
Additional terms and conditions for distribution The use of the BIOLOGICAL RESOURCE is restricted to the academic researches conducted by non-profit organization. By using this material, the RECIPIENT agrees to be bound by the conditions of the limited use statement of the Promega Corporation.
Ordering Please visit Information of Request for Distribution. 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA) [Word]
Distribution information (domestic users) [open/close]

Catalog # Resource name Shipping form Fee (non-profit org.)
RDB05812 pKM2L-phKIT DNA solution

Ordering Information [in Japanese] [in English]
Please review the QC test results indicated by check icon below as well as clone information before placing your order.

References and tips

Electronic file

Original reference

Further references such as user reports and related articles (go to bottom)

Featured content

Featured content Promoter Collection (Renilla Luciferase) (English text)

Sequence information

RIKEN BRC has sequenced portions of this material for quality test.
Please review the QC test results indicated by check icon as well as clone information before placing your order.

Test sheet RDB13911_A6Aep1.pdf check

Nucleotide sequence of a portion of this resource (if available).

Primer: M13_-40
Sequence file: RDB13911_A6Aea.seq check
Primer: pAxCALNL_F1
Sequence file: RDB13911_A6Aeb.seq check

Please visit Sequencing and PCR primers for primer information.


Original, user report and related articles

user report Kim, K.L., Direct and differential effects of stem cell factor on the neovascularization activity of endothelial progenitor cells. Cardiovasc Res. 92 (1): 132-140 (2011). PMID 21636540.
