Resource data sheet
Prev.

pKM2L-phKIT

Promoter Bank clone, Human c-kit promoter

Catalog number RDB05812
Resource name pKM2L-phKIT
Alternative name p2007-39F
Clone info. The Human c-kit promoter sequence (PCR-amplified 331 bp) was inserted into a Renilla luciferase reporter vector pKM2L (RDB4026).
Forward primer, 2007F2- SpeI: 5' gatcactagtaggggtggaaaggtggagagaga 3'; Reverse primer, 2007R2- SalI: 5' gatcgtcgaccgcggtagctgcgatgggat 3' (reference: Jpn. J. Cancer Res., 84, 1136-1144, 1993, PMID:7506248)
Vector backbone pKM2L (RDB4026) (Plasmid)
Size of vector backbone 4.2 kb
Selectable markers Kan^r
Gene/insert name Human c-kit genomic DNA
Reference of nucleotide sequence AC006552 (DDBJ accession number)
Depositor DNA Bank, |
 
Other clones in our bank human KIT (NCBI Gene 3815) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR 1. The RECIPIENT agrees to use the BIOLOGICAL RESOURCE only for academic research in the non-profit organization. 2. In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.
Additional terms and conditions for distribution The use of the BIOLOGICAL RESOURCE is restricted to the academic researches conducted by non-profit organization. By using this material, the RECIPIENT agrees to be bound by the conditions of the limited use statement of the Promega Corporation.
Ordering Please visit Information of Request for Distribution. 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA) [Word]
Distribution information (domestic users) [open/close]


Catalog # Resource name Shipping form Fee (non-profit org.)
RDB05812 pKM2L-phKIT DNA solution

Ordering Information [in Japanese] [in English]

References and tips

Electronic file

Featured content

Featured content Promoter Collection (Renilla Luciferase) (English text)

References

User reports and related articles (go to bottom)


Sequence information

RIKEN BRC has sequenced portions of this material for quality test. Primers and the results are shown below.

Data are summerized on test sheet below.

Test sheet RDB13911_A6Aep1.pdf

Nucleotide sequence of a portion of this resource (if available).

Primer: M13_-40 RDB13911_A6Aea.seq
>05812_13911_A6Ae_2_M13(-40)_B05_05.ab1
    1 AGGCAGTCAG CTTGCATGCC TGCAGGTCAT TTAAATAGGG ATAACAGGGT AATGATTAAG
   61 ATCTCGAGCT CTAAGCTTCA CATATGCATG CACTAGTAGG GGTGGAAAGG TGGAGAGAGA
  121 AAGGGGCTCC GGAGTCAAGA GCGGGGAGAG AGGGCGCGCG CGCCCTCCTC CTCCCGGCGG
  181 GCACAGCCCC CCGGCATTAA CACGTCGAAA GAGCAGGGGC CAGACGCCGC CGGGAAGAAG
  241 CGAGACCCGG GCGGGCGCGA GGGAGGGGAG GCGAGGAGGG GCGTGGCCGG CGCGCAGAGG
  301 GAGGGCGCTG GGAGGAGGGG CTGCTGCTCG CCGCTCGCGG CTCTGGGGGC TCGGCTTTGC
  361 CGCGCTCGCT GCACTTGGGC GAGAGCTGGA ACGTGGACCA GAGCTCGGAT CCCATCGCAG
  421 CTACCGCGGT CGACGCGTAG AATTCACCCG GGTACTGCAG AAGTTGGTCG TGAGGCACTG
  481 GGCAGGTAAG TATCAAGGTT ACAAGACAGG TTTAAGGAGA CCAATAGAAA CTGGGCTTGT
  541 CGAGACAGAG AAGACTCTTG CGTTTCTGAT AGGCACCTAT TGGTCTTACT GACATCCACT
  601 TTGCCTTTCT CTCCACAGGT GTCCACTCCC AGTTCAATTA CAGCTCTTAA GGCTAGAGTA
  661 CTTAATACGA CTCACTATAG GCTAGCCACC ATGGCTTCCA AGGTGTACGA CCCCGAGCAA
  721 CGCAAACGCA TGATCACTGG GCCTCAGTGG TGGGCTCGCT GCAAGCAAAT GAACGTGCTG
  781 GACTCCTTCA TCAACTACTA TGATTCCGAG AAGCACGCCG AGAACGCCGT GATTTTTCTG
  841 CATGGTAACG CTGCCTCCAG CTACCTGTGG AGGCACGTCG TGCCTCACAT CGAGCCCGTG
  901 GCTAGATGCA TCATCCCTGA TCTGATCGGA ATGGGTAAGT CCGGCAAGAG CGGGAAATGG
  961 CTCATATCGC CTCCTGGATC ACTACAAGTA CCCTCACCGC TTGGTTCGAG CTGCTGAACC
 1021 CTTCCCAATG AAAATCATCT TTTGTGGGCC ACGACTGGGG GGGGCTTTGT CTGGGCTTTT
 1081 CACTACTCTA CGAGCACAAG ACCAAGATCC AGTCAATCGG TCCATGCTTG GAGAAGGTGT
1141 GTTCCGGTTG GAACCGGTGT GAC
//
Primer: pAxCALNL_F1 RDB13911_A6Aeb.seq
>05812_13911_A6Ae_2_pAxCALNL_F1_E05_14.ab1
    1 ATAATGTATC TTATCATGTC TGCTCGAAGC GGCCGCTCTA GAATTACTGC TCGTTCTTCA
   61 GCACGCGCTC CACGAAGCTC TTGATGTACT TACCCATTTC ATCTGGAGCG TCCTCCTGGC
  121 TGAAGTGGAG GCCCTTCACC TTCACGAACT CGGTGTTAGG GAACTTCTTA GCTCCCTCGA
  181 CAATAGCGTT GGAAAAGAAC CCAGGGTCGG ACTCGATGAA CATCTTAGGC AGATCGTCGC
  241 TGGCCCGAAG GTAGGCGTTG TAGTTGCGGA CAATCTGGAC GACGTCGGGC TTGCCTCCCT
  301 TAACGAGAGG GATCTCGCGA GGCCAGGAGA GGGTAGGCCG TCTAACCTCG CCCTTCTCCT
  361 TGAATGGCTC CAGGTAGGCA GCGAACTCCT CAGGCTCCAG TTTCCGCATG ATCTTGCTTG
  421 GGAGCATGGT CTCGACGAAG AAGTTATTCT CAAGCACCAT TTTCTCGCCC TCTTCGCTCT
  481 TGATCAGGGC GATATCCTCC TCGATGTCAG GCCACTCGTC CCAGGACTCG ATCACGTCCA
  541 CGACACTCTC AGCATGGACG ATGGCCTTGA TCTTGTCTTG GTGCTCGTAG GAGTAGTGAA
  601 AGGCCAGACA AGCCCCCCAG TCGTGGCCCA CAAAGATGAT TTTCTTTGGA AGGTTCAGCA
  661 GCTCGAACCA AGCGGTGAGG TACTTGTAGT GATCCAGGAG GCGATATGAG CCATTCCCGC
  721 TCTTGCCGGA CTTACCCATT CCGATCAGAT CAGGGATGAT GCATCTAGCC ACGGGCTCGA
  781 TGTGAGGCAC GACGTGCCTC CACAGGTAGC TGGAGGCAGC GTTACCATGC AGAAAAATCA
  841 CGGCGTTCTC GGCGTGCTTC TCGGAATCAT AGTAGTTGAT GAAGGAGTCC AGCACGTTCA
  901 TTTGCTTGCA GCGAGCCCAC CACTGAGGCC CAGTGATCAT GCGTTTGCGT TGCTCGGGGT
  961 CGTACACCCT TGGAAAGCCA TGGTGGCTAG CCTATAGTGA GTCGTATTAA GTACTCTAGC
 1021 CCTTAAGAGC TGTAATTTGA AACTGGGGAG TGGACACCTG TGGAGGAGAA GGCAAAAGTG
 1081 AATGTCAGTT AGATATAGTG CTTATCAGAA CGCAGAGTCC TTCCTCTGTC TCGACAAAGC
1141 CAGTTTTCTA ATTTGC
//

Please visit Sequencing and PCR primers for primer information.


References

References

user report Kim, K.L., Direct and differential effects of stem cell factor on the neovascularization activity of endothelial progenitor cells. Cardiovasc Res. 92 (1): 132-140 (2011). PMID 21636540.

2018.12.10

GNP_filter3_RDBDEP_html_181012.pl