Resource data sheet
Prev.
Please review the QC test results indicated by check icon below as well as clone information before placing your order.

pKM2L-phGCG

Promoter Bank clone, Human glucagon promoter

Catalog number RDB05490
Resource name pKM2L-phGCG
Alternative name p1898-1F
Clone info. PCR amplified human glucagon promoter sequence was inserted into a Renilla luciferase reporter vector pKM2L (RDB04026). Cloned fragment: 162153856 to 162152194(NC_000002.12); relatively -1452 to +211, where +1 corresponds to 1 nt of NM_002054.4.
PCR cloning, forward primer, 1898F-SpeI: 5' gactactagtctagaccgacctaaggcttgacacc 3'; reverse primer, 1898R-SalI: 5' gactgtcgacagagagcaagccctctttgggaac 3'; Entire sequence of promoter region has not been confirmed. Promoter activity has not been analyzed.
Vector backbone pKM2L (RDB04026) (Plasmid)
Size of vector backbone 4.2 kb
Selectable markers Kan^r
Gene/insert name Human glucagon genomic DNA
Reference of nucleotide sequence AC007750 (DDBJ accession number)
Depositor|Developer DNA Bank, |
 
Other clones in our bank human GCG (NCBI Gene 2641) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR 1. The RECIPIENT agrees to use the BIOLOGICAL RESOURCE only for academic research in the non-profit organization. 2. In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.
Additional terms and conditions for distribution The use of the BIOLOGICAL RESOURCE is restricted to the academic researches conducted by non-profit organization. By using this material, the RECIPIENT agrees to be bound by the conditions of the limited use statement of the Promega Corporation.
Ordering Please visit Information of Request for Distribution. 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA) [Word]
Distribution information (domestic users) [open/close]


Catalog # Resource name Shipping form Fee (non-profit org.)
RDB05490 pKM2L-phGCG DNA solution

Ordering Information [in Japanese] [in English]
Please review the QC test results indicated by check icon below as well as clone information before placing your order.

References and tips

Electronic file

Original reference

Further references such as user reports and related articles (go to bottom)

Featured content


Sequence information

RIKEN BRC has sequenced portions of this material for quality test.
Please review the QC test results indicated by check icon as well as clone information before placing your order.

Test sheet RDB05490_A6A7p1.pdf check

Nucleotide sequence of a portion of this resource (if available).

Primer: M13_-40
Sequence file: RDB05490_A6A7a.seq check
>05490_05490_A6A7_2_M13(-40)_B10_04.ab1
    1 CGGGGGTCAG CTTGCATGCC TGCAGGTCAT TTAATAGGGA TAACAGGGTA ATGATTAAGA
   61 TCTCGAGCTC TAAGCTTCAC ATATGCATGC ACTAGTCTAG ACCGACCTAA GGCTTGACAC
  121 CTTTCTCTGC TCTTTCACCC CCTCTGCTGG TAGAGTGCCA AGAAGCAGGT CTCAGATCAA
  181 GACACCAGCA GTACCAATGA GGAGATAAAG TGAGGCAGAT ATTTTATGCA GCTGTGCTTC
  241 TCAAATTTTA ATATGAACAC AGATTTCCTT AGGATTTTGT TAAAATACAG ATTCTGATAG
  301 GCACGAGATT CTGCATTTCT AGCAAGCTCC CAGATGATGC TGGTCCTTAG ACCACACTTT
  361 GCAAAGCAAG GCTTTCTAGC ACCCAATAAT CACCAGCACA AAAACCCCTC AATGATGTCT
  421 TCCAGTCTGA CTTGAAAGTG ATCTCTGTGG CCTTCAAGTA GCTCTACATT CAAACGTTGG
  481 TCTCATGCAC AAATTGAACA GTTAAGTTCA TTTGGAATAT TTCTCCAGTT GCCTCAATGA
  541 TTTACCTCCA TACAAGTCAT CAGTGACATC ATGCGGTTGG TTATATTAGA ATATTGGAAT
  601 CTAGTTAGGA AATGTTGTGA TGAGTTTGCA ATATGGAATA AAATTTTTAT TTTAGAAAAG
  661 ACATTTACCA ACCCCTCTCA TTTTACAAAT AAGGAGGCAG AGACACAAAG AGAATGCGTG
  721 ACTTGACCAA GGTCACACAG CTGGTCAATA ACAGCAAAAC TAAAATCAAA TTATGCCAAC
  781 ACTACTTCTT ATGCTGTCTT TCCAGATTAT TTACCATTTT TCTATCTCTC TACAGTGACC
  841 AGAATCATTT CTGCTAAATG TCACAGATCA TTAAAGCCTG TGTGTCCAGT CACAAAACTC
  901 AGGAAACGTG AAAATATGCA TCTCATCTCA ACAGTTTTTC CTCATATCTC ATTCTTTTGT
  961 AAACTTAGTA CCCCCACTCT CTTATCAGTA AAAATTTAGA TTTTTTAAAT ATATATTAGA
 1021 ATGGAAAAAA ATACCCAGAT CATTTCCTGG CTAGCATTCA GCTATTCTTG GCATGCTTTT
1081 AATTCCATCG A
//
Primer: phRLR2
Sequence file: RDB05490_A6A7b.seq check
>05490_05490_A6A7_2_phRLR2_E10_13.ab1
    1 ATCCAGACTC GAAGCCCAGT TTCTATTGGT CTCCTTAACC TGTCTTGTAA CCTTGATACT
   61 TACCTGCCCA GTGCCTCACG ACCAACTTCT GCAGTACCCG GGTGAATTCT ACGCGTCGAC
  121 AGAGAGCAAG CCCTCTTTGG GAACTTTTGA TGTGCTCTGT GTCCTAAGCT CTGTACTTCT
  181 GCACCAAGGC GCACTGCTTT TATATACTCT CCAGCTCTGT TTAGCCTCAC AGATATTACG
  241 CTGACAATAT AAATTTCTCA TCTGTAAATA ATGAGTTTTT GTTACAAATG ACTTCCCTCT
  301 CCCACTCACT TTGCTCATCT GCATTCTATG CTTATATTGG GTGAGAGACC TTAGAGACCT
  361 GGAAACTTTT TATGCACTCT TGTATCTTTT TTTTTTTTTG GTTGGGAATG GAGAGAGCAG
  421 CTTGGAAATC CACCTTCTAC TTTCAATCAC GCATGAAAAT CACTTAAGTT CTCTAAAGTG
  481 AATTTTGACG TTGAAGACAA AAGACCTTGA AATTACGTAG CCCATGGCCA TCCCTGTTTT
  541 GTGCATGTCC TCATTTGAGG TTCTTACAAG TCTTTGGTTT GCTACCTAGC CATGATGAAT
  601 TTACCTGAAT ATAACAATCA CTTCAGTCAT TCATTTATCT AAATAATGAT CATTCATTCA
  661 ACACATATGT ATTAAAAATC CTCTCTTCCT CACAACGTGG AGTTTATTTA TGTTATGTTT
  721 GTGGAAAATT TAAGGATATT GATTAAACCC CTATGTGTTC TGTTTTAATA AATGGAATTC
  781 AGGCAGAAAG GATGGAGCAA AATGAAGATT AAACATCCAA GATAGCTGAT GCTAACAGGA
  841 AATTATCTGG TATTTTTTTC CTTCTAATAT ATATTTAAAA TCTAATTTTA CTGATAAGAG
  901 AGTGGGGTAC TAAGTTACAA AAGAATGAGA TATGAGGAAA ACTGTTTGAG ATGAGATGCA
  961 TATTTTTCAC GTTTCCCTGA GTTTTGTGAC TGGACACACA GGCTTTAAAT GATCTGTGAC
 1021 ATTTAGCCAG AAATTGAATC CTGGTTCACT GTAGAGCATA GCAACAATGC TCAATAAGTC
1081 TGGCAAAAGG ACCAGGCATT AAG
//
Primer: pAxCALNL_F1
Sequence file: RDB05490_A6A7c.seq check
>05490_05490_A6A7_2_pAxCALNL_F1_H10_22.ab1
    1 TAGGTATCTT ATCATGTCTG CTCGAGCGGC CGCTCTAGAA TTACTGCTCG TTCTTCAGCA
   61 CGCGCTCCAC GAAGCTCTTG ATGTACTTAC CCATTTCATC TGGAGCGTCC TCCTGGCTGA
  121 AGTGGAGGCC CTTCACCTTC ACGAACTCGG TGTTAGGGAA CTTCTTAGCT CCCTCGACAA
  181 TAGCGTTGGA AAAGAACCCA GGGTCGGACT CGATGAACAT CTTAGGCAGA TCGTCGCTGG
  241 CCCGAAGGTA GGCGTTGTAG TTGCGGACAA TCTGGACGAC GTCGGGCTTG CCTCCCTTAA
  301 CGAGAGGGAT CTCGCGAGGC CAGGAGAGGG TAGGCCGTCT AACCTCGCCC TTCTCCTTGA
  361 ATGGCTCCAG GTAGGCAGCG AACTCCTCAG GCTCCAGTTT CCGCATGATC TTGCTTGGGA
  421 GCATGGTCTC GACGAAGAAG TTATTCTCAA GCACCATTTT CTCGCCCTCT TCGCTCTTGA
  481 TCAGGGCGAT ATCCTCCTCG ATGTCAGGCC ACTCGTCCCA GGACTCGATC ACGTCCACGA
  541 CACTCTCAGC ATGGACGATG GCCTTGATCT TGTCTTGGTG CTCGTAGGAG TAGTGAAAGG
  601 CCAGACAAGC CCCCCAGTCG TGGCCCACAA AGATGATTTT CTTTGGAAGG TTCAGCAGCT
  661 CGAACCAAGC GGTGAGGTAC TTGTAGTGAT CCAGGAGGCG ATATGAGCCA TTCCCGCTCT
  721 TGCCGGACTT ACCCATTCCG ATCAGATCAG GGATGATGCA TCTAGCCACG GGCTCGATGT
  781 GAGGCACGAC GTGCCTCCAC AGGTAGCTGG AGGCAGCGTT ACCATGCAGA AAAAATCACG
  841 GCGTTCTCGG CGTGCTTCTC GGAATCATAG TAGTTGATGA AGGAGTCCAG CACGTTCATT
  901 TGCTTGCAGC GAGCCCACCC ACTGAGGCCC AGTTGATCAT GCGTTTGCGT TTGCTCGGGG
  961 GTTCGGTACA CCTTTGCAAG CCCATGGTGG CCTTAGCTAT AGTGAGTCGT AATAGGTACT
1021 CTAGCCCTTT AGGAGCTGTA ATGAACTTGG TAGTGACACC T
//

Please visit Sequencing and PCR primers for primer information.


References

Original, user report and related articles


2020.02.12

GNP_filter3_RDBDEP_html_191130.pl