Resource data sheet
Prev.
Please review the QC test results indicated by check icon below as well as clone information before placing your order.

pCMV-MAZ

Human MAZ cDNA is cloned into EcoRI site of pcDNA3

Catalog number RDB03219
Resource name pCMV-MAZ
Alternative name pCMV-MAZi
Clone info. Human MAZ cDNA is cloned into EcoRI site of pcDNA3.
The DNA fragment corresponds to 1..1760nt of NM_002383.4. Known differences (at least): T to C substitution at 4nt, 29 bp(GAGCCCGGGCCCCGCGCGGCCCGCGCCCC) deletion at 96 to 124nt, C to T substitution at 149nt, 15 bp(GGCGGCAGCGGCAGC) deletion at 1493 to 1507nt.
In the case of a DNA fragment corresponding to 1..1738nt of D85131.1. Known differences (at least): T to C substitution at 8nt, T to CGC substitution at 14nt, insertion of G between 15 and 16nt, insertion of G between 31 and 32nt, insertion of G between 34 and 35nt, insertion of G between 53 and 54nt, T to CG substitution at 68nt, insertion of G between 74 and 75nt, insertion of G between 81 and 82nt, insertion of C between 82 and 83nt, deletion of A at 97nt, deletion of C at 99nt, insertion of 7 bp (CGGGGGC) at 123 to 124nt, insertion of C between 127 and 128nt, insertion of G between 131 and 132nt, deletion of G at 141nt, insertion of C between 144 and 145nt, insertion of G between 147 and 148nt, insertion of G between 160 and 161nt, T to G substitution at 241nt.
Vector backbone pcDNA3 (Plasmid)
Size of vector backbone 5.446 bp
Selectable markers Amp^r
Gene/insert name Human MAZ cDNA
Reference of nucleotide sequence D85131 (DDBJ accession number)
Depositor|Developer Yokoyama, Kazunari | Song, Jun |
 
Other clones in our bank human MAZ (NCBI Gene 4150) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR Manuscripts for the publication shall be made through the discussion between Developer/Depositor and Recipient Investigator. Recipient investigator shall include Depositor/Developer as co-author in manuscript for the publication. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of literature(s) designated by the DEPOSITOR is requested. (Biochem. Biophys. Res. Commun., 226, 801-809 (1996).) Recipient Investigator shall negotiate with Developer/Depositor when patent application and the commercialization for the products based upon Material, derivatives thereof their use is considered.
Ordering Please visit Information of Request for Distribution.[link] 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA for use for not-for-profit academic purpose) [Word]
Distribution information (domestic users) [open/close]


Catalog # Resource name Shipping form Fee (non-profit org.)
RDB03219 pCMV-MAZ DNA solution

Ordering Information [in Japanese] [in English]
Please review the QC test results indicated by check icon below as well as clone information before placing your order.

References and tips

Electronic file

Original reference

original Tsutsui, H., Members of the MAZ family: a novel cDNA clone for MAZ from human pancreatic islet cells. Biochem. Biophys. Res. Commun., 226, 801-809 (1996). PMID 8831693.

Further references such as user reports and related articles (go to bottom)

Featured content


Sequence information

RIKEN BRC has sequenced portions of this material for quality test.
Please review the QC test results indicated by check icon as well as clone information before placing your order.

Test sheet RDB18960_B1Dkp1-1.pdf check

Nucleotide sequence of a portion of this resource (if available).

Primer: CMV_Forward
Region: inseert 5'
Sequence file: RDB18960_B1Dka.seq check
>03219_18960_B1Dk_2_CMV-Forward_A02_02_ABI24.ab1
    1 NNNNNNNNNN NNNNNNNNNN NNACCCACNG CTTACNGGCT TATCGAAATT AATACGACTC
   61 ACTATAGGGA GACCCAAGCT TGGTACCGAG CTCGGATCCA CTAGTAACGG CCGCCAGTGT
  121 GCTGGAATTC CCGGGGTCGC CGCGGCGCTC CGCGGCCCGC AAGGCGCCCT CCTTTCCTCC
  181 CTCCCGCCGG CCGGGGTGCG CGGGCGGCGG GGCGGCCCGC GGGCCATGCG TTCGGCGCGG
  241 CCCAGCCCGG CCGGCCGGGG GCGGCGCCCC CGGCCCCCGC TGAGCCCTGG GGGCCCCGCT
  301 GCGGCCGAGG CCATGTTCCC GGTGTTTCCT TGCACGCTGC TGGCCCCCCC CTTCCCCGTG
  361 CTGGGCCTGG ACTCCCGGGG GGTGGGCGGC CTCATGAACT CCTTCCCGCC ACCTCAGGGT
  421 CACGCCCAGA ACCCCCTGCA GGTCGGGGCT GANCTCCAGT CCCGCTTCTT TGCCTCCCAG
  481 GGCTGCGCCC AGAGTCCATT CCAGGCCGCG CCGGCGCCCC CGCCCACGCC CCANGCCCCN
  541 GCGGCCGANC CCCTCCAGGT GGANTTGCTC CCGGTGCTCG CCGCCGCCCA GGANTCCGCC
  601 GCGGCTGCTG CNGCCGCTGC CGCCGCTGCT GCCNNNNTCN CNNNCNNNCC CCNNGNCCCN
661 NNNNNNNNN
//
Primer: bGH_rev3
Region: insert 3'
Sequence file: RDB18960_B1Dkb.seq check
>03219_18960_B1Dk_2_bGH_rev3_B02_05_ABI24.ab1
    1 NNNNNNNNNN NNNNNNNNNN NCNNNAGCAT TTAGGTGACA CTATAGAATA GGGCCCTCTA
   61 GATGCATGCT CGAGCGGCCG CCAGTGTGAT GGATATCTGC AGAATTCCCC TAAGAAAACA
  121 TTTCTTCCTC CTTTCCTTCT GGAGGCTCCT TGGTTGGTAG GGAAATAGGA GTTGGTGGGA
  181 AAAGAGGGGG GAGAGGAGCT TGTACCAAGG GACTCTACTC CATTCTCCCC TCTCCCCCGC
  241 AACCAACTTG GAGCTCACCA GGGTTGGGAG GGAAGTGGCT GAGAGCTCAC AGGCACCCCC
  301 TCCGCCCCCG AGAGGGAGCC CACAGCTGTG GGAGGGGCTG CTACTGCTGC CGCTGCTGCC
  361 GCTGCCGCCG CCATTGGACA AACCTCACCA GTACCTTTGT TGCAGAGCTC ACAGACATGG
  421 TGAGGACCCT GGCTGTGCAC CTTCATGTGG TCCGAAATAT AAGCCGAGCT CAGCATCTTG
  481 CCACACACGT GACATGGCAC TTTCTCCTCN TGTCGTACTG TGTGCGCCCG CAGCCNATCC
  541 TTCNTGGCGA AAGCTGNCCT CNCATTTCTC ACATTTGAAN GGCCGTTCTG TTGANTGCNC
  601 TTGNCTGANN TGANNGTTGA NGTGATNNNG CCNGGANNNN CTCTTGCCAN NNNNNNGNNN
661 CNNNNNNNNG GNNNNNNGNN NNNNNNCNNN NNNNNNN
//
Primer: SV40pro_ori_F
Region: NeoR
Sequence file: RDB18960_B1Dkc.seq check
>03219_18960_B1Dk_2_SV40pro_ori_F_C02_08_ABI24.ab1
    1 NNNNNNNNNN NNNNNNNNNN NANAANCNNC CGGGAGCTTN NATATCCATT TTCGGATCNG
   61 ATCAAGAGAC AGGATGAGGA TCGTTTCGCA TGATTGAACA AGATGGATTG CACGCAGGTT
  121 CTCCGGCCGC TTGGGTGGAG AGGCTATTCG GCTATGACTG GGCACAACAG ACAATCGGCT
  181 GCTCTGATGC CGCCGTGTTC CGGCTGTCAG CGCAGGGGCG CCCGGTTCTT TTTGTCAAGA
  241 CCGACCTGTC CGGTGCCCTG AATGAACTGC AGGACGAGGC AGCGCGGCTA TCGTGGCTGG
  301 CCACGACGGG CGTTCCTTGC GCAGCTGTGC TCGACGTTGT CACTGAAGCG GGAANGGACT
  361 GGCTGCTATT GGGCGAANTG CCNGGGCANG NNCTCCTGTC NTCTCACCTT GCTCCTGCCN
  421 ANAAAGTATC CNTCATGGNT GANGCNANGC NGCGGCTGNN TACNCTTGAT NCNGCTACCN
481 GCCNNTTNNA CNNNCNAGCN AANNNTCNNN TCNANNGANC NNNTANNNNN NNNNN
//

Please visit Sequencing and PCR primers for primer information.


References

Original, user report and related articles

original Tsutsui, H., Members of the MAZ family: a novel cDNA clone for MAZ from human pancreatic islet cells. Biochem. Biophys. Res. Commun., 226, 801-809 (1996). PMID 8831693.
user report Cogoi, S., MAZ-binding G4-decoy with locked nucleic acid and twisted intercalating nucleic acid modifications suppresses KRAS in pancreatic cancer cells and delays tumor growth in mice. Nucleic Acids Res., 41(7):4049-4064 (2013). PMID 23471001.
user report Tsui K.H., Mechanisms by which Interleukin-6 Regulates Prostate Specific Antigen Gene Expression in Prostate LNCaP Carcinoma Cells. J. Androl. 32 (4): 383-393 (2011). PMID 21051589.
user report Membrino, A., G4-DNA Formation in the HRAS Promoter and Rational Design of Decoy Oligonucleotides for Cancer Therapy. PLoS One. 6 (9): e24421 (2011). PMID 21931711.
user report Milena, M., Involvement of ubiquitous and tale transcription factors, as well as liganded RXR alpha, in the regulation of human SOX2 gene expression in the NT2/D1 embryonal carcinoma cell line. Arch. Biol. Sci., Belgrade, 62, 199-210 (2010).
user report Cogoi S., The KRAS promoter responds to Myc-associated zinc finger and poly(ADP-ribose) polymerase 1 proteins, which recognize a critical quadruplex-forming GA-element. J. Biol. Chem., 285, 22003-22016 (2010). PMID 20457603.
user report Frensing T., Characterization of a neuregulin-1 gene promoter: positive regulation of type I isoforms by NF-kappaB. Biochim. Biophys. Acta - Gene Regul. Mech., 1779, 139-144 (2008). PMID 18082154.

2021.06.02

GNP_filter3_RDBDEP_html_210503.pl