Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS187M24

Clone ID RBdS187M24
HP ID HP00829
Gene ID 7458
Gene Symbol EIF4H
Protein Name eukaryotic translation initiation factor 4H
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_031992.1
Length of RefSeq (bp) 2486
Chromosome 7q11.23
Reference DDBJ accession
UniGene Hs.520943
5'-terminal sequence GATATTGCGGGGTCCTTCCTCGCTCACCCTGGTTCCTCTCGGAGCGGAGACGGCAAATGG
2011.08.28