Prev. | Human A to Z list > E > 

RIKEN DNA Bank Human Resource - EIF4H

Gene ID (NCBI) 7458
Gene Symbol EIF4H
Protein Name eukaryotic translation initiation factor 4H
Synonyms WBSCR1|WSCR1|eIF-4H
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY067041 IRAK167K01 pBluescriptR BC066928 NM_031992 Full
HGY087087 IRAL017L23 pOTB7 BC021214 NM_031992 Full
HGY090813 IRAL027A13 pOTB7 BC010021 NM_031992 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR160858 ARi02C10 pGCAP10 NM_031992.1
GGTTCCTCTCGGAGCGGAGACGGCAAATGGCGGACTTCGACACCTACGACGATCGGGCCT
HKR180052 ARi50C04 pGCAP10 NM_031992.1
GGGTTCCTCTCGGAGCGGAGACGGCAAATGGCGGACTTCGACACCTACGACGATCGGGCC
HKR182005 ARi55A05 pGCAP10 NM_031992.1
GCTCTCGGAGCGGAGACGGCAAATGGCGGACTTCGACACCTACGACGATCGGGCCTACAG
HKR187752 ARi69G08 pGCAP10 NM_031992.1
GGGTTCCTCTCGGAGCGGAGACGGCAAATGGCGGACTTCGACACCTACGACGATCGGGCC
HKR074978 ARe87H10 pKA1U5 NM_031992.1
GGTTCCTCTCGGAGCGGAGACGGCAAATGGCGGACTTCGACACCTACGACGATCGGGCCT
HKR243681 ARiS109D09 pGCAP10 NM_031992.1
GGCGGAGACGGCAAATGGCGGACTTCGACACCTACGACGATCGGGCCTACAGCAGCTTCG
HKR260344 ARiS150O08 pGCAP10 NM_031992.1
GGNNNCNTCTCGGAGCGGANACGGCAAATGGCGGACTTCGACACCTACGACGATCGGGCC
HKR361704 RBd04E08 pGCAP10 NM_031992.1
GGGTTCCTCTCGGAGCGGAGACGGCAAATGGCGGACTTCGACACCTACGACGATCGGGCC
HKR327610 RBb19A10 pKA1U5 NM_031992.1
GCTGGTTCCTCTCGGAGCGGAGACGGCAAATGGCGGACTTCGACACCTACGACGATCGGG
HKR330455 RBb26C07 pGCAP1 NM_031992.1
GCTGGTTCCTCTCGGAGCGGAGACGGCAAATGGCGGACTTCGACACCTACGACGATCGGG
HKR405607 RBdS014A07 pGCAP10 NM_031992.1
GCTGGTTCCTCTCGGAGCGGAGACGGCAAATGGCGGACTTCGACACCTACGACGATCGGG
HKR442030 RBdS105B06 pGCAP10 NM_031992.1
GGGTTCCTCTCGGAGCGGAGACGGCAAATGGCGGACTTCGACACCTACGACGATCGGGCC
HKR444239 RBdS110J23 pGCAP10 NM_031992.1
GGGTTCCTCTCGGAGCGGAGACGGCAAATGGCGGACTTCGACACCTACGACGATCGGGCC
HKR474952 RBdS187G08 pGCAP10 NM_031992.1
GATATTGCGGGGTCCTTCCTCGCTCACCCTGGTTCCTCTCGGAGCGGAGACGGCAAATGG
HKR475112 RBdS187M24 pGCAP10 NM_031992.1
GATATTGCGGGGTCCTTCCTCGCTCACCCTGGTTCCTCTCGGAGCGGAGACGGCAAATGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.03

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl